Upload
Featured Recent Articles Topics Login Upload

Search Results for 'Genome.'

Genome. published presentations and documents on DocSlides.

Quantifying contributions of mutations and homologous reco
Quantifying contributions of mutations and homologous reco
by ellena-manuel
genomic . diversity. Sergei . Maslov. Department ...
Introduction to epigenetics: chromatin modifications, DNA m
Introduction to epigenetics: chromatin modifications, DNA m
by ellena-manuel
CpG. Island . landscape (part 2). Héctor. Corr...
The Pathways over Time Project
The Pathways over Time Project
by trish-goza
A one-semester research project in comparative fu...
Genome Sciences 373
Genome Sciences 373
by min-jolicoeur
Genome Informatics . Q. uiz Section . 9. May 26 2...
Phycodnaviridae
Phycodnaviridae
by karlyn-bohler
Abigail S. Clark. MCB 5505: General Virology. Pho...
Algenol’s proprietary enhanced algae, AB1, are
Algenol’s proprietary enhanced algae, AB1, are
by celsa-spraggs
non-invasive. to local SWFL waters . and get out...
Genomics
Genomics
by liane-varnes
interventions towards fast-track development of ....
Marker heritability
Marker heritability
by myesha-ticknor
Biases, confounding factors, current methods, and...
MCB 3421 class 25
MCB 3421 class 25
by aaron
s. tudent evaluations. Please follow this link to...
John Sherwood
John Sherwood
by tatyana-admore
1. , Victoria Torres. 1. , Jasmina Cunmulaj. 1. ,...
Wrapup
Wrapup
by danika-pritchard
NHGRI strategic plan. What does the NIH think gen...
Joseph Loquasto
Joseph Loquasto
by tatiana-dople
Department . of Food Science. The Pennsylvania St...
Transcriptomics
Transcriptomics
by pasty-toler
Jim Noonan. GENE 760. Transcriptomics. Introducti...
Introduction To Next Generation Sequencing (NGS) Data Anal
Introduction To Next Generation Sequencing (NGS) Data Anal
by ellena-manuel
Jenny Wu. UCI Genomics High Throughput Facility. ...
http://cs273a.stanford.edu [Bejerano Fall16/17]
http://cs273a.stanford.edu [Bejerano Fall16/17]
by lindy-dunigan
1. CS273A. Lecture . 14: . Inferring Evolution: C...
http://cs273a.stanford.edu [BejeranoFall14/15]
http://cs273a.stanford.edu [BejeranoFall14/15]
by giovanna-bartolotta
1. MW  . 12:50-2:05pm . in Beckman . B100. Profs...
Cufflinks
Cufflinks
by conchita-marotz
Matt . Paisner. , . Hua. He, Steve Smith and Bri...
Haploid-Diploid Evolutionary Algorithms
Haploid-Diploid Evolutionary Algorithms
by stefany-barnette
Larry Bull. UWE. SEX. . A Social Interaction in ...
Genetic
Genetic
by giovanna-bartolotta
“. Engineering. ”. for Crop Improvement. Xiw...
Introduction To Next Generation Sequencing (NGS) Data Anal
Introduction To Next Generation Sequencing (NGS) Data Anal
by karlyn-bohler
Jenny . Wu. Outline. Goals : Practical guide to N...
SOM Tutorial
SOM Tutorial
by pamella-moone
Camden Jansen. Mortazavi. Lab. csjansen@uci.edu....
Molecular Biology Primer
Molecular Biology Primer
by aaron
Starting 19. th. century…. Cellular biology:. ...
Mechanisms of Genetic Variation
Mechanisms of Genetic Variation
by cheryl-pisano
1. 16. Copyright © McGraw-Hill Global Education ...
Dhanvantari
Dhanvantari
by stefany-barnette
. . GenOME. to hit. ...
False negatives are common
False negatives are common
by yoshiko-marsland
with . initial and follow-up . biopsies.. Patient...
A Zero-Knowledge Based Introduction to Biology
A Zero-Knowledge Based Introduction to Biology
by min-jolicoeur
Karthik . Jagadeesh. , Bo . Yoo. 28. . September...
Bioinformatics and Genetics
Bioinformatics and Genetics
by yoshiko-marsland
Kun Huang. Department of Biomedical Informatics. ...
GCATCCATCTTGGGGCGTCCCAATTGCTGAGTAACAAATGAGACGC CGTACTGCAACCGGCGGGCCACG
GCATCCATCTTGGGGCGTCCCAATTGCTGAGTAACAAATGAGACGC CGTACTGCAACCGGCGGGCCACG
by test
Lecture 4 Much of the genome remains to be annotat...
Hidden magicians of genome evolution
Hidden magicians of genome evolution
by alexa-scheidler
C. Sandeep Kumar, Sameera Fatima Qureshi, Altaf Al...
A genome-wide perspective on translation of proteins
A genome-wide perspective on translation of proteins
by conchita-marotz
Dec 2012. Regulatory Genomics. Lecturer: Prof. Yi...
Plant Molecular Systematics
Plant Molecular Systematics
by test
Spring . 2012. “Problems” with morphological....
RNA-Seq Primer
RNA-Seq Primer
by giovanna-bartolotta
Understanding the RNA-Seq evidence tracks on . th...
Dwarfism
Dwarfism
by tatiana-dople
in . Sorghum . bicolor. . converted. . by. . ...
A brief guide to sequencing
A brief guide to sequencing
by conchita-marotz
Dr Gavin Band. Wellcome. Trust Advanced Courses;...
Costs and benefits of sexual reproduction:
Costs and benefits of sexual reproduction:
by celsa-spraggs
The . disadvantages and advantages of sexual . re...
Techniques of Molecular Biology
Techniques of Molecular Biology
by faustina-dinatale
Basic molecular biology techniques. Isolating nuc...
Outbreak of
Outbreak of
by alexa-scheidler
E. coli . O104:H4 heralds a new paradigm in respo...
GE3M25:
GE3M25:
by giovanna-bartolotta
Data Analysis. Karsten Hokamp, PhD. Genetics. TCD...
Brettanomyces
Brettanomyces
by tatyana-admore
Aroma and Flavor Effects. Lucy Joseph. Departmen...
Genome-Wide Association Study (GWAS)
Genome-Wide Association Study (GWAS)
by liane-varnes
Presented by Karen . Xu. What you need to know. B...