PPT-Genome assembly BIO 446L/546L- Fall 2019
Author : aaron | Published Date : 2020-04-03
Purbendra yogi Introduction Genome assembly is the process of taking of many short DNA sequences and combine them to form original chromosome First generation Assembly
Presentation Embed Code
Download Presentation
Download Presentation The PPT/PDF document " Genome assembly BIO 446L/546L- Fall 201..." is the property of its rightful owner. Permission is granted to download and print the materials on this website for personal, non-commercial use only, and to display it on your personal computer provided you do not modify the materials and that you retain all copyright notices contained in the materials. By downloading content from our website, you accept the terms of this agreement.
Genome assembly BIO 446L/546L- Fall 2019: Transcript
Purbendra yogi Introduction Genome assembly is the process of taking of many short DNA sequences and combine them to form original chromosome First generation Assembly began in the late 1980s and early 1990s. Denovo genome Denovo genome outline outline novogenome from contigs from assembled contigs annotation Denovo genome Denovo genome Reads contig Gene Gene Annotation Gene Annotation Forgene sequencing . for . identification,. detection, . and control of . Bactrocera dorsalis (. Hendel. ). and other Tephritid pests. Thomas Walk, Scott . Geib. USDA-ARS Pacific Basin Agricultural Research Center, Hilo HI. Abhiram. Ranade. IIT Bombay. Genome. Constituent of living cells that determines hereditary characteristics a.k.a. DNA. Sequence of . nucleobases. : . A. denine, . G. uanine, . T. hymine, . C. ytosine. School of Engineering. Assembler. Reference. Abyss 1.5.1. Simpson et al., J. T., Wong, K., Jackman, S. D., Schein, J. E., Jones,. . S. J., and . Birol. , I. (2009). Abyss: a parallel assembler for. . Suzanna Kim. Hema Nagrajan. Deepak Purushotham. AMBILY SIVADAS. AMIT RUPANI. LEO WU. Genome Assembly . Final Results. 02 -22- 2012. Outline. Pipeline for evaluation. Quantitative evaluation. Qualitative Evaluation. By Kevin Chen, . Lior. . Pachter. PLoS. Computational Biology, 2005. David Kelley. State of . metagenomics. In July 2005, 9 projects had been completed.. General challenges were becoming apparent. Paper focuses on computational problems. Kerstin Lindblad-Toh1 et al.. Presentation by:. Keara Flores. Gustavo Diaz Cruz. Background. Human genome sequenced in 2003 and researchers learned 1.5% of it codes proteins. . 2005 Lindblad-Toh and colleagues begin effort to sequence domestic dog producing a SNP map allows for comparative analysis of the mammalian genome. . terrestris. , . the buff-tailed bumble bee. Native to Europe. A managed pollinator. Commercially available. Reared in greenhouses. Important pollinator in greenhouses and in agricultural fields. Adorable. Sequencing and Fragment Assembly. AGTAGCACAGACTACGACGAGACGATCGTGCGAGCGACGGCGTAGTGTGCTGTACTGTCGTGTGTGTGTACTCTCCT. 3x10. 9. nucleotides. Sequence Assembly. cut many times at random (. Shotgun. ). genomic segment. shinisaurus. . crocodilurus. Jian . gao. , . qiye. li, . zongji. . wang. , yang . zhou. , . paolo. . martelli. , fang li, . zijun. . xiong. , . jian. . wang. , . huanming. yang, and . guojie. . Genome: the total number of genes in an individual.. Human Genome- approx. 20,000 genes on the 46 human chromosomes.. Human Genome Project (HGP). Ongoing effort to completely map and sequence our genome.. j.abbott@dundee.ac.uk. What is assembly?. Assembly approaches. Short-read assembly. Long-read assembly. Hybrid assembly. Validation. Annotation. Overview. From your home directory, run the following command:. Chris Fields. Genome Assembly | Saba Ghaffari | 2020. 1. PowerPoint by Saba Ghaffari. Introduction. Exercise . Perform a bacterial genome assembly using PacBio HiFi data.. Evaluation and comparison of different datasets and parameters.. Richard Gibbs and George Weinstock man Genome Sequencing Center ) genome was sequenced in a project (12). This was the third mammalian project complex collaboration led by the BCM-HGSC (BAC skims, w
Download Document
Here is the link to download the presentation.
" Genome assembly BIO 446L/546L- Fall 2019"The content belongs to its owner. You may download and print it for personal use, without modification, and keep all copyright notices. By downloading, you agree to these terms.
Related Documents
