Explore
Upload

DocSlides is a free service to upload presentations and documents.

Upload Now

Search Results for 'Genome Tumor'

Genome Tumor published presentations and documents on DocSlides.

Genome Editing In the Clinic

Genome Editing In the Clinic

  • liane-varnes
  • 33 Slides

Fyodor D. Urnov, PhD. Project Leader and Senior S...

Dysregulation

Dysregulation

  • kittie-lecroy
  • 28 Slides

of the miR-34a-SIRT1 axis inhibits breast. cance...

Genome Analysis of

Genome Analysis of

  • olivia-moreira
  • 23 Slides

L. . donovani. . : revealing the correlation of ...

Approaching early stage disease

Approaching early stage disease

  • trish-goza
  • 28 Slides

Surgery . vs. SBRT . vs. RFA. November 16, 2012...

Incidence of Mild Cognitive Impairment

Incidence of Mild Cognitive Impairment

  • yoshiko-marsland
  • 10 Slides

(MCI) in. Irradiated . Brain Tumor Survivors. N M...

LATERAL NECK MASSES

LATERAL NECK MASSES

  • sherrill-nordquist
  • 65 Slides

Prof. . Alam. Presented By:. Hazem Aljumah. Moham...

A high-resolution map of human evolutionary constraints usi

A high-resolution map of human evolutionary constraints usi

  • trish-goza
  • 27 Slides

Kerstin . Lindblad-. Toh. . et al. . 2011. Prese...

Genome-Wide Association Study (GWAS)

Genome-Wide Association Study (GWAS)

  • liane-varnes
  • 27 Slides

Presented by Karen . Xu. What you need to know. B...

Detecting selection using genome scans

Detecting selection using genome scans

  • ellena-manuel
  • 36 Slides

Roger Butlin. University of Sheffield. Nielsen R....

Pediatric Pathology

Pediatric Pathology

  • alexa-scheidler
  • 37 Slides

Qinshi. Pan. Orange is stuff she said in class �...

Integrative Oncology

Integrative Oncology

  • danika-pritchard
  • 68 Slides

Gary E. Foresman, MD. February 2012. “In 2010, ...

Target therapy for bone metastatic prostate cancer with Mic

Target therapy for bone metastatic prostate cancer with Mic

  • kittie-lecroy
  • 24 Slides

Alexandre . Iscaife. ; Denis Reis Morais; Sabrina...

Brettanomyces

Brettanomyces

  • tatyana-admore
  • 31 Slides

Aroma and Flavor Effects. Lucy Joseph. Departmen...

Nanotechnology and cancer

Nanotechnology and cancer

  • min-jolicoeur
  • 12 Slides

Maria Guirguis. Dr. Sun. Biomedical Engineering S...

2 years later, she noticed multiple 1.5 -2 cm. nodular mass

2 years later, she noticed multiple 1.5 -2 cm. nodular mass

  • alexa-scheidler
  • 17 Slides

Breast Cancer Recurrence. anytime, mostly occur i...

Mieloma

Mieloma

  • marina-yarberry
  • 25 Slides

Múltiple. Padilla Arias Jesús Salvador. Univers...

Viral Evolution in

Viral Evolution in

  • ellena-manuel
  • 21 Slides

Endosymbionts. February 11, . 2012. Seth Bordenst...

GE3M25:

GE3M25:

  • giovanna-bartolotta
  • 71 Slides

Data Analysis. Karsten Hokamp, PhD. Genetics. TCD...

NorCal

NorCal

  • alexa-scheidler
  • 25 Slides

. SOT Fall . Symposium: . New . Frontiers in Onc...

Advances in immunotherapy for lymphomas and myelomas

Advances in immunotherapy for lymphomas and myelomas

  • phoebe-click
  • 29 Slides

Larry W. Kwak, M.D., Ph.D.. Chairman, Departmen...

Outbreak of

Outbreak of

  • alexa-scheidler
  • 28 Slides

E. coli . O104:H4 heralds a new paradigm in respo...

TGCAAACTCAAACTCTTTTGTTGTTCTTACTGTATCATTGCCCAGAATAT

TGCAAACTCAAACTCTTTTGTTGTTCTTACTGTATCATTGCCCAGAATAT

  • olivia-moreira
  • 43 Slides

TCTGCCTGTCTTTAGAGGCTAATACATTGATTAGTGAATTCCAATGGGC...

CS B553: Algorithms for Optimization and Learning

CS B553: Algorithms for Optimization and Learning

  • test
  • 35 Slides

Linear programming, quadratic programming, sequen...

Web-based analysis of (epi-) genome data using EpiGRAPH and Christoph

Web-based analysis of (epi-) genome data using EpiGRAPH and Christoph

  • pamella-moone
  • 100 Slides

http://galaxyproject.org/ for genome and epigenome...

The Autism Genome Project and Genocide

The Autism Genome Project and Genocide

  • danika-pritchard
  • 23 Slides

The Unbearable Uncertainty of Being (Autistic). P...

Techniques of Molecular Biology

Techniques of Molecular Biology

  • faustina-dinatale
  • 64 Slides

Basic molecular biology techniques. Isolating nuc...

Costs and benefits of sexual reproduction:

Costs and benefits of sexual reproduction:

  • celsa-spraggs
  • 22 Slides

The . disadvantages and advantages of sexual . re...

Advancement in Personalized Imaging

Advancement in Personalized Imaging

  • pamella-moone
  • 29 Slides

David Cheng, MD, PhD. Division Chief of Nuclear M...

Endocrine System

Endocrine System

  • pamella-moone
  • 37 Slides

Structures. Group of ductless glands that secrete...

The impact of next-generation sequencing technology of gene

The impact of next-generation sequencing technology of gene

  • sherrill-nordquist
  • 37 Slides

Elaine R. . Mardis. – 11 . February. . 2008. W...

A brief guide to sequencing

A brief guide to sequencing

  • conchita-marotz
  • 30 Slides

Dr Gavin Band. Wellcome. Trust Advanced Courses;...

Environmental Genome Shotgun Sequencing of the Sargasso Sea

Environmental Genome Shotgun Sequencing of the Sargasso Sea

  • jane-oiler
  • 18 Slides

Venter et. al (2004). Presented by. Ken . Vittaya...

Dwarfism

Dwarfism

  • tatiana-dople
  • 7 Slides

in . Sorghum . bicolor. . converted. . by. . ...

GEP Curriculum for Beginning STEM Majors

GEP Curriculum for Beginning STEM Majors

  • alexa-scheidler
  • 16 Slides

GEP Alumni Consortium. NSF Improving Undergraduat...

RNA-Seq Primer

RNA-Seq Primer

  • giovanna-bartolotta
  • 22 Slides

Understanding the RNA-Seq evidence tracks on . th...

Plant Molecular Systematics

Plant Molecular Systematics

  • test
  • 37 Slides

Spring . 2012. “Problems” with morphological....

RESEARCHARTICLEOpenAccess

RESEARCHARTICLEOpenAccess

  • luanne-stotts
  • 100 Slides

Tumor-infiltratingimmunecellprofilesandtheir chang...

RESEARCHARTICLEOpenAccess

RESEARCHARTICLEOpenAccess

  • olivia-moreira
  • 100 Slides

PrognosticsignificanceofFOXP3+ tumor-infiltratingl...

A genome-wide perspective on translation of proteins

A genome-wide perspective on translation of proteins

  • conchita-marotz
  • 35 Slides

Dec 2012. Regulatory Genomics. Lecturer: Prof. Yi...

Heap Growth Detection in C++

Heap Growth Detection in C++

  • sherrill-nordquist
  • 42 Slides

GrowthTracker. 1. Heap Growth Detection in C++. M...

Copyright © 2024 DocSlides. All Rights Reserved