Search Results for 'Genome-Phosphate'

Genome-Phosphate published presentations and documents on DocSlides.

Finishing Phage Genomes
Finishing Phage Genomes
by faustina-dinatale
How to identify circularly permuted genomes, phys...
Introduction to Short Read Sequencing Analysis
Introduction to Short Read Sequencing Analysis
by sherrill-nordquist
Jim Noonan. GENE 760. Sequence read lengths remai...
Global Variation in Copy Number
Global Variation in Copy Number
by ellena-manuel
in the Human Genome. Redon et. al.. Presentation ...
Genome Read In-Memory (GRIM) Filter:
Genome Read In-Memory (GRIM) Filter:
by faustina-dinatale
Fast Location Filtering in DNA Read Mapping using...
Working Group Meeting
Working Group Meeting
by tawny-fly
February 29, 2016. 1. 888-844-9904. passcode . 2...
Dr. George Church
Dr. George Church
by tatiana-dople
Professor,. . Department of Genetics. Harvard Me...
Molecular Biology of Cancer AND
Molecular Biology of Cancer AND
by mitsue-stanley
Cancer Informatics (omics). David Boone. Outline....
Riann
Riann
by briana-ranney
. Egusquiza. D145 Presentation. January 12, 2017...
Assembly and Annotation of a 22Gb
Assembly and Annotation of a 22Gb
by tatiana-dople
C. onifer . G. enome, Loblolly Pine. Jill Wegrzyn...
Dr G P S Raghava, Head Bioinformatics Centre
Dr G P S Raghava, Head Bioinformatics Centre
by conchita-marotz
Institute of Microbial Technology, Chandigarh, In...
GEP Curriculum for Beginning STEM Majors
GEP Curriculum for Beginning STEM Majors
by alexa-scheidler
GEP Alumni Consortium. NSF Improving Undergraduat...
The impact of next-generation sequencing technology of gene
The impact of next-generation sequencing technology of gene
by sherrill-nordquist
Elaine R. . Mardis. – 11 . February. . 2008. W...
The Autism Genome Project and Genocide
The Autism Genome Project and Genocide
by danika-pritchard
The Unbearable Uncertainty of Being (Autistic). P...
Web-based analysis of (epi-) genome data using EpiGRAPH and Christoph
Web-based analysis of (epi-) genome data using EpiGRAPH and Christoph
by pamella-moone
http://galaxyproject.org/ for genome and epigenome...
TGCAAACTCAAACTCTTTTGTTGTTCTTACTGTATCATTGCCCAGAATAT
TGCAAACTCAAACTCTTTTGTTGTTCTTACTGTATCATTGCCCAGAATAT
by olivia-moreira
TCTGCCTGTCTTTAGAGGCTAATACATTGATTAGTGAATTCCAATGGGC...
Viral Evolution in
Viral Evolution in
by ellena-manuel
Endosymbionts. February 11, . 2012. Seth Bordenst...
Detecting selection using genome scans
Detecting selection using genome scans
by ellena-manuel
Roger Butlin. University of Sheffield. Nielsen R....
A high-resolution map of human evolutionary constraints usi
A high-resolution map of human evolutionary constraints usi
by trish-goza
Kerstin . Lindblad-. Toh. . et al. . 2011. Prese...
ENCODE 2012
ENCODE 2012
by conchita-marotz
The Human Genome project sequenced “the human g...
Governance, Regulation, and Control:
Governance, Regulation, and Control:
by celsa-spraggs
Of Which People, By Which People, For Which Peopl...
HandbookHelp Me Understand GeneticsThe Human Genome ProjectReprinted f
HandbookHelp Me Understand GeneticsThe Human Genome ProjectReprinted f
by stefany-barnette
Chapter 10The Human Genome ProjectTable of Content...
GASiC: Metagenomic abundance estimation and diagnostic
GASiC: Metagenomic abundance estimation and diagnostic
by sherrill-nordquist
testing on . species level. Martin Lindner. , Ber...
CRISPR bacon: a sizzling technique to generate genetically
CRISPR bacon: a sizzling technique to generate genetically
by yoshiko-marsland
DeMayo. FJ, Spencer TE. Jennifer Thornton. April...
On Genome Assembly
On Genome Assembly
by karlyn-bohler
Abhiram. Ranade. IIT Bombay. Genome. Constituent...
Genomics Virtual Lab:
Genomics Virtual Lab:
by pamella-moone
analyze . your data with a mouse click. Igor Maku...
Course Overview
Course Overview
by luanne-stotts
02-223 Personalized Medicine:. Understanding Your...
Budding Technologies and Budding Yeast
Budding Technologies and Budding Yeast
by alida-meadow
2012 HHMI Summer Workshop for High School Scienc...
Translating NGS Data into a Clinically Actionable Assay
Translating NGS Data into a Clinically Actionable Assay
by danika-pritchard
Elaine R. Mardis, Ph.D.. Professor of Genetics. C...
Where in a Genome Does DNA Replication Begin?
Where in a Genome Does DNA Replication Begin?
by calandra-battersby
Algorithmic Warm-Up. Phillip . Compeau. and Pave...
PineRefSeq
PineRefSeq
by olivia-moreira
: Conifer Reference Genome Sequencing. An Adaptiv...
Outline
Outline
by min-jolicoeur
Whole Genome Assembly. How it works. How to make ...
Sequencing extinct human ancestors
Sequencing extinct human ancestors
by kittie-lecroy
Credits to Vanessa Patel for some of the slides. ...
Improving RAST annotations within RAST
Improving RAST annotations within RAST
by tatiana-dople
Veronika Vonstein. Fellowship for Interpretation ...
University of Connecticut
University of Connecticut
by min-jolicoeur
School of Engineering. Assembler. Reference. Abys...
Jeri Dilts
Jeri Dilts
by karlyn-bohler
Suzanna Kim. Hema Nagrajan. Deepak Purushotham. A...
Genomics and Personalized Care in Health Systems
Genomics and Personalized Care in Health Systems
by lois-ondreau
Lecture 5 Genome Browser. Leming Zhou, PhD. Schoo...
Sequence Comparison and
Sequence Comparison and
by cheryl-pisano
Genome Alignment in the Human Genome. Jian. Ma....
Fast and accurate short read alignment with Burrows–Wheel
Fast and accurate short read alignment with Burrows–Wheel
by danika-pritchard
transform. Heng. Li and Richard Durbin∗. Membe...
The exam  was written based on 100 points. Dr. Cline will w
The exam was written based on 100 points. Dr. Cline will w
by danika-pritchard
Important . – please keep your answers short; c...
cs3102: Theory of Computation
cs3102: Theory of Computation
by marina-yarberry
Class 26: . NP-Complete Entr. é. es. (DNA with a...