Explore
Upload

DocSlides is a free service to upload presentations and documents.

Upload Now

Search Results for 'Genome Access'

Genome Access published presentations and documents on DocSlides.

Biometrical Model and the Genome and its secrets

Biometrical Model and the Genome and its secrets

  • jasmine
  • 42 Slides

Benjamin Neale, PhD. Boulder Workshop. Content war...

Genome Annotation BCB 660

Genome Annotation BCB 660

  • cadie
  • 10 Slides

October 20, 2011. From Carson Holt. Annotations. A...

GENOME BROWSERS In the previous lection we have talked about sequence annotation (functional and st

GENOME BROWSERS In the previous lection we have talked about sequence annotation (functional and st

  • byrne
  • 24 Slides

However, genomes are large and complex and visuali...

National Center for Genome Analysis Support:

National Center for Genome Analysis Support:

  • anya
  • 33 Slides

http://ncgas.org. . Carrie . Ganote. Ram . Podich...

Bioinformatics in the Dynamic Genome Course

Bioinformatics in the Dynamic Genome Course

  • desha
  • 26 Slides

Introducing Freshmen to computational biology. Uni...

Introduction to your genome

Introduction to your genome

  • ava
  • 46 Slides

CSE291: Personal Genomics for . Bioinformaticians....

Genome Assembly G enome

Genome Assembly G enome

  • isla
  • 3 Slides

assembly. Illumina. Subsample. Summarize. Assemble...

Genome-wide longitudinal analysis of

Genome-wide longitudinal analysis of

  • elysha
  • 18 Slides

emm1. invasive Group A . Streptococcus. isolated...

Tech-Talk UCSC Genome Browser

Tech-Talk UCSC Genome Browser

  • arya
  • 4 Slides

December 2, 2019. Mustafa Albahrani. Talk’s part...

De Novo Assembly of Mitochondrial Genomes from Low Coverage Whole-Genome Sequencing Reads

De Novo Assembly of Mitochondrial Genomes from Low Coverage Whole-Genome Sequencing Reads

  • vivian
  • 26 Slides

Fahad Alqahtani and Ion Mandoiu. University of Con...

Social Genome: Putting Big Data to Work to Advance Society

Social Genome: Putting Big Data to Work to Advance Society

  • cheryl-pisano
  • 47 Slides

Hye-Chung Kum. Texas A&M Health Science Cente...

The i5k Workspace@NAL – enabling genomic data access, visualization and

The i5k Workspace@NAL – enabling genomic data access, visualization and

  • breezeibm
  • 18 Slides

curation. for the i5k community. Monica Poelchau ...

Global Variation in Copy Number

Global Variation in Copy Number

  • ellena-manuel
  • 18 Slides

in the Human Genome. Redon et. al.. Presentation ...

Nucleosomes : what, why and where?

Nucleosomes : what, why and where?

  • danya
  • 42 Slides

Rob Brewster. Outline. What is a . nucleosome. ?. ...

The role of the National Agricultural Library in arthropod genomics research

The role of the National Agricultural Library in arthropod genomics research

  • barbara
  • 14 Slides

- implementing and . developing tools for . genomi...

Access to plant genome assemblies allows a better understanding of the diversity in plant species.

Access to plant genome assemblies allows a better understanding of the diversity in plant species.

  • tabitha
  • 1 Slides

complexity of some plants . (very high genome size...

HandbookHelp Me Understand GeneticsThe Human Genome ProjectReprinted f

HandbookHelp Me Understand GeneticsThe Human Genome ProjectReprinted f

  • stefany-barnette
  • 8 Slides

Chapter 10The Human Genome ProjectTable of Content...

GASiC: Metagenomic abundance estimation and diagnostic

GASiC: Metagenomic abundance estimation and diagnostic

  • sherrill-nordquist
  • 20 Slides

testing on . species level. Martin Lindner. , Ber...

CRISPR bacon: a sizzling technique to generate genetically

CRISPR bacon: a sizzling technique to generate genetically

  • yoshiko-marsland
  • 13 Slides

DeMayo. FJ, Spencer TE. Jennifer Thornton. April...

On Genome Assembly

On Genome Assembly

  • karlyn-bohler
  • 23 Slides

Abhiram. Ranade. IIT Bombay. Genome. Constituent...

Genomics Virtual Lab:

Genomics Virtual Lab:

  • pamella-moone
  • 14 Slides

analyze . your data with a mouse click. Igor Maku...

Course Overview

Course Overview

  • luanne-stotts
  • 35 Slides

02-223 Personalized Medicine:. Understanding Your...

Budding Technologies and Budding Yeast

Budding Technologies and Budding Yeast

  • alida-meadow
  • 49 Slides

2012 HHMI Summer Workshop for High School Scienc...

Translating NGS Data into a Clinically Actionable Assay

Translating NGS Data into a Clinically Actionable Assay

  • danika-pritchard
  • 41 Slides

Elaine R. Mardis, Ph.D.. Professor of Genetics. C...

Where in a Genome Does DNA Replication Begin?

Where in a Genome Does DNA Replication Begin?

  • calandra-battersby
  • 62 Slides

Algorithmic Warm-Up. Phillip . Compeau. and Pave...

PineRefSeq

PineRefSeq

  • olivia-moreira
  • 20 Slides

: Conifer Reference Genome Sequencing. An Adaptiv...

DNA Interlude

DNA Interlude

  • phoebe-click
  • 12 Slides

Classwork. Introduce yourself to your neighbor. E...

Mapping NGS sequences to a reference genome

Mapping NGS sequences to a reference genome

  • debby-jeon
  • 18 Slides

Why?. Resequencing. studies (DNA). Structural va...

Introduction to Short

Introduction to Short

  • lindy-dunigan
  • 37 Slides

Read Sequencing . Analysis. Jim Noonan. GENE 760....

DNA Sequencing

DNA Sequencing

  • lois-ondreau
  • 49 Slides

Method to sequence longer regions. cut many times...

TGCAAACTCAAACTCTTTTGTTGTTCTTACTGTATCATTGCCCAGAATAT

TGCAAACTCAAACTCTTTTGTTGTTCTTACTGTATCATTGCCCAGAATAT

  • luanne-stotts
  • 45 Slides

TCTGCCTGTCTTTAGAGGCTAATACATTGATTAGTGAATTCCAATGGGC...

Software for Robust Transcript Discovery and Quantification

Software for Robust Transcript Discovery and Quantification

  • marina-yarberry
  • 27 Slides

Seq. Ion . Mandoiu. , Alex . Zelikovsky. , . Serg...

GNUMap

GNUMap

  • stefany-barnette
  • 24 Slides

:. . Unbiased Probabilistic Mapping of Next-Gene...

Biggest

Biggest

  • alexa-scheidler
  • 19 Slides

Ever . Maths. and Science Lesson. Investigating ...

Positional cloning:

Positional cloning:

  • test
  • 69 Slides

the rest of the story. http://faculty.ithaca.edu/...

Crosslink

Crosslink

  • karlyn-bohler
  • 13 Slides

Y. Lyse & Sonicate. IP. Reverse crosslinks. T...

In latent infection- retroviral genome is present but is no

In latent infection- retroviral genome is present but is no

  • stefany-barnette
  • 7 Slides

Distinguished by qPCR (DNA) and qRT-PCR (RNA). Re...

Vocabulary Study for “how to live a 100 years”

Vocabulary Study for “how to live a 100 years”

  • luanne-stotts
  • 28 Slides

superannuated. (adj.) old and therefore no longer...

Genetic Approaches to Rare Diseases:

Genetic Approaches to Rare Diseases:

  • alida-meadow
  • 28 Slides

What has worked and what may work for AHC. Erin L...

Genome mapping

Genome mapping

  • giovanna-bartolotta
  • 49 Slides

Genome sequencing. Next Gen sequencing. Genome ma...

Copyright © 2024 DocSlides. All Rights Reserved