Upload
Featured Recent Articles Topics Login Upload

Search Results for 'Genome-Reads'

Genome-Reads published presentations and documents on DocSlides.

Practical Guide to the (mod)ENCODE project
Practical Guide to the (mod)ENCODE project
by mitsue-stanley
February . 27 2013. Fundamental Goals. Improve co...
“An
“An
by trish-goza
integrated encyclopedia of DNA elements in the hu...
Cells
Cells
by stefany-barnette
Are we done yet?. Answer: Almost.. What do we nee...
Virus Life Cycles in 3D
Virus Life Cycles in 3D
by olivia-moreira
The Art of Reconstruction. In order to survive, v...
Vibrio
Vibrio
by luanne-stotts
genome analysis. Christina. Isabella. Roland. Sa...
Last lecture summary
Last lecture summary
by briana-ranney
Sequencing strategies. Hierarchical genome shotgu...
P řednáška 13. 3. odpadá
P řednáška 13. 3. odpadá
by sherrill-nordquist
Last lecture summary. recombinant DNA technology....
How do Replication and Transcription Change Genomes?
How do Replication and Transcription Change Genomes?
by conchita-marotz
Andrey Grigoriev. Director, Center for Computatio...
The Pines
The Pines
by tawny-fly
October 28, . 2013. Genomic Medicine. Malcolm Cam...
Predicting Genes in Mycobacteriophages
Predicting Genes in Mycobacteriophages
by phoebe-click
December . 8. , 2014. 2014 In . S. ilico. Worksh...
Presenting:
Presenting:
by karlyn-bohler
On the immortality of television sets: “functio...
DNA Interlude
DNA Interlude
by phoebe-click
Classwork. Introduce yourself to your neighbor. E...
TGCAAACTCAAACTCTTTTGTTGTTCTTACTGTATCATTGCCCAGAATAT
TGCAAACTCAAACTCTTTTGTTGTTCTTACTGTATCATTGCCCAGAATAT
by luanne-stotts
TCTGCCTGTCTTTAGAGGCTAATACATTGATTAGTGAATTCCAATGGGC...
Positional cloning:
Positional cloning:
by test
the rest of the story. http://faculty.ithaca.edu/...
Biggest
Biggest
by alexa-scheidler
Ever . Maths. and Science Lesson. Investigating ...
Crosslink
Crosslink
by karlyn-bohler
Y. Lyse & Sonicate. IP. Reverse crosslinks. T...
In latent infection- retroviral genome is present but is no
In latent infection- retroviral genome is present but is no
by stefany-barnette
Distinguished by qPCR (DNA) and qRT-PCR (RNA). Re...
Vocabulary Study for “how to live a 100 years”
Vocabulary Study for “how to live a 100 years”
by luanne-stotts
superannuated. (adj.) old and therefore no longer...
Genetic Approaches to Rare Diseases:
Genetic Approaches to Rare Diseases:
by alida-meadow
What has worked and what may work for AHC. Erin L...
Genome mapping
Genome mapping
by giovanna-bartolotta
Genome sequencing. Next Gen sequencing. Genome ma...
EBI web resources II:
EBI web resources II:
by celsa-spraggs
Ensembl. and . InterPro. Yanbin Yin. Fall 2014. ...
Human Sequencing
Human Sequencing
by natalia-silvester
Stefano . Lise. Bioinformatics & Statistical ...
Proteogenomics
Proteogenomics
by alexa-scheidler
Kelly Ruggles, Ph.D. . Proteomics Informatics. We...
IMPRS workshop
IMPRS workshop
by alexa-scheidler
Comparative Genomics. 18. th. -21. st. of Februa...
The IWGSC:
The IWGSC:
by briana-ranney
Strategies & Activities to Sequence the Bread...
Polysaccharide A
Polysaccharide A
by olivia-moreira
a. widely distributed . immunoregulatory. micro...
BIO 508
BIO 508
by phoebe-click
Comparative Genomics. Eric Franzosa, PhD. 2 April...
Getting Started with IGV
Getting Started with IGV
by pasty-toler
Programming for Biology 2015. Madelaine Gogol. Pr...
BE/APh161 – Physical Biology of the Cell
BE/APh161 – Physical Biology of the Cell
by tatiana-dople
Rob Phillips. Applied Physics and Bioengineering....
Purposes and features
Purposes and features
by lois-ondreau
Browse genes in their genomic context.. See featu...
The Wealth Genome Program Audio Digital
The Wealth Genome Program Audio Digital
by Hictle63
The Wealth Genome is an audio program that activat...
KAMAL LOCHAN SARMA ASSITANT PROFESSOR
KAMAL LOCHAN SARMA ASSITANT PROFESSOR
by joaquin618
DEPARTMENT OF ZOOLOGY. General structure and class...
Synthetic biology platforms for high-resolution access to the
Synthetic biology platforms for high-resolution access to the
by noe847
modified. human proteome . Human proteins exhibit...
Figure 1 Figure 1. . . A) Genome organization of dog circovirus (DogCV) and porcine circovirus 2 (P
Figure 1 Figure 1. . . A) Genome organization of dog circovirus (DogCV) and porcine circovirus 2 (P
by julien
Li L, McGraw S, Zhu K, Leutenegger CM, Marks SL, K...
Bacterial Enzyme Produces Biodegradable Polymer
Bacterial Enzyme Produces Biodegradable Polymer
by blaze
1. S.S. Macdonald, J.H. Pereira, F. Liu, G. Tegl, ...
Ch 14 Human Inheritance
Ch 14 Human Inheritance
by unita
Human inheritance involves more issues than pea pl...
By: Leeya Ressom BIG DATA
By: Leeya Ressom BIG DATA
by belinda
. AT . PANDORA MEDIA, INC. . . What is Pandora R...
Genome evolution Lecture 2:
Genome evolution Lecture 2:
by layla
population genetics I: models and drift. Reading. ...
The Genome Aggregation Database (
The Genome Aggregation Database (
by elizabeth
gnomAD. ). Konrad Karczewski. March 4, 2019. @konr...
Content Proteomics Types of proteomic
Content Proteomics Types of proteomic
by mary
Application of proteomic. Genomics . Application o...