Explore
Upload

DocSlides is a free service to upload presentations and documents.

Upload Now

Search Results for 'Wrf Sbatch'

Wrf Sbatch published presentations and documents on DocSlides.

Using HPC for Ansys CFX and Fluent

Using HPC for Ansys CFX and Fluent

  • lindy-dunigan
  • 28 Slides

John Zaitseff, . March 2016. High Performance Com...

Using the BYU Supercomputers

Using the BYU Supercomputers

  • danika-pritchard
  • 11 Slides

Resources . Basic Usage. After your account is ac...

Getting Started: XSEDE Comet

Getting Started: XSEDE Comet

  • natalia-silvester
  • 17 Slides

. Shahzeb Siddiqui - sms5713@psu.edu. Software...

HPC at HCC

HPC at HCC

  • yoshiko-marsland
  • 13 Slides

Jun Wang. . hcc.unl.edu. Outline of . Workshop3...

Working on UC Davis Bioinformatics Core Administrated Compu

Working on UC Davis Bioinformatics Core Administrated Compu

  • yoshiko-marsland
  • 40 Slides

Outline. Introduction/Questions. Explain . user s...

Steve Leak, and Zhengji

Steve Leak, and Zhengji

  • briana-ranney
  • 65 Slides

. Zhao. NESAP . Hack-a-thon. November 29, 2016, ...

HPC at HCC Jun Wang hcc.unl.edu

HPC at HCC Jun Wang hcc.unl.edu

  • mitsue-stanley
  • 0 Slides

Outline of . Workshop3. Overview . of Current HPC...

Getting Started: XSEDE Comet

Getting Started: XSEDE Comet

  • liane-varnes
  • 0 Slides

. Shahzeb Siddiqui - sms5713@psu.edu. Software...

Welcome to Kamiak 10/2/2017 Training Session

Welcome to Kamiak 10/2/2017 Training Session

  • trish-goza
  • 0 Slides

Aurora Clark, CIRC Director. Peter Mills, Computa...

Using Longleaf ITS Research Computing Karl Eklund Sandeep

Using Longleaf ITS Research Computing Karl Eklund Sandeep

  • calandra-battersby
  • 60 Slides

Using Longleaf ITS Research Computing Karl Eklund...

Introduction - The basics of compiling and running on KNL

Introduction - The basics of compiling and running on KNL

  • kaptainpositive
  • 50 Slides

Zhengji. Zhao. User Engagement Group . Cori KNL U...

Running VASP on Cori KNL

Running VASP on Cori KNL

  • reportssuper
  • 55 Slides

Zhengji. Zhao. User Engagement Group . Hands-on V...

BioinformaticsCodeLornaEDrakeCodes18wererunusingbashcodeonCardi27Univ

BioinformaticsCodeLornaEDrakeCodes18wererunusingbashcodeonCardi27Univ

  • payton
  • 6 Slides

grep16CTACTAAGACGAGAAAGACCCT17R01fastqx0000R01Fora...

UPR - Department of Biology

UPR - Department of Biology

  • cadie
  • 31 Slides

College of Natural Resource. Río Piedras Campus. ...

Bacterial Genome Assembly

Bacterial Genome Assembly

  • nicole
  • 33 Slides

Chris Fields. Genome Assembly | Saba Ghaffari | 20...

Introduction to RNA-Seq & Transcriptome Analysis

Introduction to RNA-Seq & Transcriptome Analysis

  • cady
  • 46 Slides

Jessica Holmes. 1. PowerPoint by Shayan Tabe Bordb...

Regulatory Genomics Lab Regulatory Genomics | Saurabh Sinha | 2021

Regulatory Genomics Lab Regulatory Genomics | Saurabh Sinha | 2021

  • Dreamsicle
  • 58 Slides

1. Part 1: . ChIP. -seq peak calling. Part 2. Anal...

Regulatory Genomics Lab Saurabh Sinha

Regulatory Genomics Lab Saurabh Sinha

  • CutiePie
  • 40 Slides

Regulatory. . Genomics. | Saurabh . Sinha. | 2...

NESIS estimates for the SOC case

NESIS estimates for the SOC case

  • leah
  • 19 Slides

ATM 419. Spring 2016. Fovell. 1. RIP (Read-Interpo...

Supercell storms: In-class demo and Experiment 3

Supercell storms: In-class demo and Experiment 3

  • bitsy
  • 32 Slides

ATM 419/563. Spring 2017. Fovell. 1. Goals. Start ...

Intermediate MATLAB ITS Research Computing

Intermediate MATLAB ITS Research Computing

  • adah
  • 87 Slides

Mark Reed . Lani Clough. Objectives. Intermediate....

Regulatory Genomics Lab Regulatory Genomics  | Saurabh Sinha | 2023

Regulatory Genomics Lab Regulatory Genomics  | Saurabh Sinha | 2023

  • adah
  • 61 Slides

1. Part 1: . ChIP. -seq peak calling. Part 2. Anal...

Access/log in to longleaf

Access/log in to longleaf

  • joanne
  • 107 Slides

: . ssh. or OOD. Check your quota for home, users...

Welcome to the National Physical Laboratory

Welcome to the National Physical Laboratory

  • isabella
  • 19 Slides

Simulation Based Study of a Diffusion MRI Process ...

Copyright © 2024 DocSlides. All Rights Reserved