PDF-BioinformaticsCodeLornaEDrakeCodes18wererunusingbashcodeonCardi27Univ PDF document

grep16CTACTAAGACGAGAAAGACCCT17R01fastqx0000R01ForalltxtNextextractallthereadsinthenew28lewithexactly10charactersbeforetheprimerandthenallthereadsinthenew28lewithoutexactly10bpbeforetheprimergrep16Forw

Upload by payton
Published on 2021-08-06

Presentation Embed Code

<iframe width="560" height="315" src="https://www.docslides.com/embed/858391" frameborder="0" allowfullscreen></iframe>

Download Presentation

Download Presentation The PPT/PDF document "BioinformaticsCodeLornaEDrakeCodes18were..." is the property of its rightful owner. Permission is granted to download and print the materials on this web site for personal, non-commercial use only, and to display it on your personal computer provided you do not modify the materials and that you retain all copyright notices contained in the materials. By downloading content from our website, you accept the terms of this agreement.

BioinformaticsCodeLornaEDrakeCodes18wererunusingbashcodeonCardi27Univ: Transcript

PDF-BioinformaticsCodeLornaEDrakeCodes18wererunusingbashcodeonCardi27Univ PDF document

Presentation Embed Code

Download Presentation

BioinformaticsCodeLornaEDrakeCodes18wererunusingbashcodeonCardi27Univ: Transcript

Related Contents