Explore
Upload

DocSlides is a free service to upload presentations and documents.

Upload Now

Search Results for 'Genome Genomics'

Genome Genomics published presentations and documents on DocSlides.

Analysis of imputed rare variants

Analysis of imputed rare variants

  • celsa-spraggs
  • 34 Slides

Andrew Morris. Advanced Topics in GWAS. Toronto, ...

Zhang Zhizhuo

Zhang Zhizhuo

  • olivia-moreira
  • 34 Slides

May 2010. Nucleosome. Positioning. & . Trans...

MCB 104:

MCB 104:

  • danika-pritchard
  • 27 Slides

Genetics, Cell Biology, Genomics. Fyodor Urnov, A...

Genome Analysis of

Genome Analysis of

  • cheryl-pisano
  • 26 Slides

L. . donovani. . : revealing the correlation of ...

01010110001001010000101010101001101110011000110010100010010

01010110001001010000101010101001101110011000110010100010010

  • phoebe-click
  • 32 Slides

Introduction: Human Population Genomics. ACGTTTGA...

DNA Interlude

DNA Interlude

  • phoebe-click
  • 12 Slides

Classwork. Introduce yourself to your neighbor. E...

Development and Deployment of Genomics Tools by North Ameri

Development and Deployment of Genomics Tools by North Ameri

  • myesha-ticknor
  • 4 Slides

Objectives. Develop 50K prediction equation suita...

Genome size and Complexity

Genome size and Complexity

  • sherrill-nordquist
  • 22 Slides

(as told by Michael Lynch). Genome size and compl...

Mapping NGS sequences to a reference genome

Mapping NGS sequences to a reference genome

  • debby-jeon
  • 18 Slides

Why?. Resequencing. studies (DNA). Structural va...

Plant Molecular Systematics

Plant Molecular Systematics

  • karlyn-bohler
  • 40 Slides

Spring . 2014. “Problems” with morphological....

Introduction to Short

Introduction to Short

  • lindy-dunigan
  • 37 Slides

Read Sequencing . Analysis. Jim Noonan. GENE 760....

Mistreating Health Inequities:

Mistreating Health Inequities:

  • celsa-spraggs
  • 45 Slides

The New . Biopolitics. of Race, Health & Jus...

Mitochondrial genome

Mitochondrial genome

  • sherrill-nordquist
  • 23 Slides

r. eplacement in unfertilized . o. ocytes. for . ...

Evolution of Mitochondrial Genome Architecture in Nematodes

Evolution of Mitochondrial Genome Architecture in Nematodes

  • lois-ondreau
  • 20 Slides

Sita Ping. Department of Zoology. Mentor: Dr. Dee...

GENOMICS ENGLAND AND

GENOMICS ENGLAND AND

  • yoshiko-marsland
  • 100 Slides

Page 1 of 7 THE 100,000 GENOME S PROJECT Genomic...

DNA Sequencing

DNA Sequencing

  • lois-ondreau
  • 49 Slides

Method to sequence longer regions. cut many times...

Bioinformatics for Whole-Genome Shotgun Sequencing of Micro

Bioinformatics for Whole-Genome Shotgun Sequencing of Micro

  • myesha-ticknor
  • 32 Slides

By Kevin Chen, . Lior. . Pachter. PLoS. Computa...

1 Genome sizes (sample)

1 Genome sizes (sample)

  • myesha-ticknor
  • 65 Slides

2. Some genomics history. 1995: first bacterial g...

Why bacteria run Linux

Why bacteria run Linux

  • yoshiko-marsland
  • 46 Slides

while eukaryotes . run Windows?. Sergei Maslov. B...

Mapping Irregular

Mapping Irregular

  • giovanna-bartolotta
  • 9 Slides

Computations . to GPUs. Graphics processors (GPUs...

ChIP-seq

ChIP-seq

  • yoshiko-marsland
  • 42 Slides

. Data . Analysis. Release DNA. Immunoprecipitat...

Bioinformatics

Bioinformatics

  • lois-ondreau
  • 48 Slides

. Analysis. Team . McGill . University. and . ...

The integrated cross-species

The integrated cross-species

  • luanne-stotts
  • 16 Slides

phenome. as a tool for . exploring disease. Meli...

Phylogeny

Phylogeny

  • min-jolicoeur
  • 24 Slides

- based on whole genome data. Johanne Ahrenfeldt ...

Western New York Genetics in Research Partnership

Western New York Genetics in Research Partnership

  • test
  • 18 Slides

Expanding Exposure, Career Exploration and Intera...

Accelerate your genomics and proteomics throughput with the Thermo Sci

Accelerate your genomics and proteomics throughput with the Thermo Sci

  • lois-ondreau
  • 100 Slides

The Thermo Scientic Part of Thermo Fisher Scient...

MOLECULAR BIOLOGY – PCR, sequencing, Genomics

MOLECULAR BIOLOGY – PCR, sequencing, Genomics

  • olivia-moreira
  • 57 Slides

MOLECULAR BIOLOGY TECHNIQUES II.. Polymerase Cha...

More Efficient Bioethanol from Poplar Wood?

More Efficient Bioethanol from Poplar Wood?

  • luanne-stotts
  • 12 Slides

Tues. 22. nd. May 2012, . EnergyAway. Day, . Ch...

Human Longevity™, Inc. (HLI) is the genomics-based, technology-dr

Human Longevity™, Inc. (HLI) is the genomics-based, technology-dr

  • myesha-ticknor
  • 100 Slides

company creating the world’s largest and most...

Towards your own genome

Towards your own genome

  • alexa-scheidler
  • 50 Slides

Designing. . your. . Sequencing. Run. https://...

Regulation of Gene Expression

Regulation of Gene Expression

  • conchita-marotz
  • 69 Slides

13 February, 2013. Ansuman. . Chattopadhyay. , ...

Signatures of Accelerated Somatic Evolution in Gene Promote

Signatures of Accelerated Somatic Evolution in Gene Promote

  • debby-jeon
  • 9 Slides

Update Talk. Kyle Smith. De Lab. TERT Promoter. F...

Integrated Bioinformatics

Integrated Bioinformatics

  • jane-oiler
  • 6 Slides

Data . and Analysis . Tools for . Herpesviridae. ...

TGCAAACTCAAACTCTTTTGTTGTTCTTACTGTATCATTGCCCAGAATAT

TGCAAACTCAAACTCTTTTGTTGTTCTTACTGTATCATTGCCCAGAATAT

  • luanne-stotts
  • 45 Slides

TCTGCCTGTCTTTAGAGGCTAATACATTGATTAGTGAATTCCAATGGGC...

MCB 5472

MCB 5472

  • debby-jeon
  • 42 Slides

Student . Projects,. unix. ,. . Perl . J. Peter ...

Software for Robust Transcript Discovery and Quantification

Software for Robust Transcript Discovery and Quantification

  • marina-yarberry
  • 27 Slides

Seq. Ion . Mandoiu. , Alex . Zelikovsky. , . Serg...

GNUMap

GNUMap

  • stefany-barnette
  • 24 Slides

:. . Unbiased Probabilistic Mapping of Next-Gene...

Genome Rearrangements:

Genome Rearrangements:

  • lindy-dunigan
  • 139 Slides

from Biological . Problem to . Combinatorial Algo...

Genome Rearrangements

Genome Rearrangements

  • sherrill-nordquist
  • 64 Slides

Basic Biology: DNA. Genetic information is stored...

Positional cloning:

Positional cloning:

  • test
  • 69 Slides

the rest of the story. http://faculty.ithaca.edu/...

Copyright © 2024 DocSlides. All Rights Reserved