Explore
Upload

DocSlides is a free service to upload presentations and documents.

Upload Now

Search Results for 'Genome Galaxy'

Genome Galaxy published presentations and documents on DocSlides.

Regulation of Gene Expression

Regulation of Gene Expression

  • conchita-marotz
  • 69 Slides

13 February, 2013. Ansuman. . Chattopadhyay. , ...

Signatures of Accelerated Somatic Evolution in Gene Promote

Signatures of Accelerated Somatic Evolution in Gene Promote

  • debby-jeon
  • 9 Slides

Update Talk. Kyle Smith. De Lab. TERT Promoter. F...

Integrated Bioinformatics

Integrated Bioinformatics

  • jane-oiler
  • 6 Slides

Data . and Analysis . Tools for . Herpesviridae. ...

Measuring Distances

Measuring Distances

  • tawny-fly
  • 25 Slides

Introduction. Trigonometric Parallax . Spectrosco...

TGCAAACTCAAACTCTTTTGTTGTTCTTACTGTATCATTGCCCAGAATAT

TGCAAACTCAAACTCTTTTGTTGTTCTTACTGTATCATTGCCCAGAATAT

  • luanne-stotts
  • 45 Slides

TCTGCCTGTCTTTAGAGGCTAATACATTGATTAGTGAATTCCAATGGGC...

MCB 5472

MCB 5472

  • debby-jeon
  • 42 Slides

Student . Projects,. unix. ,. . Perl . J. Peter ...

Software for Robust Transcript Discovery and Quantification

Software for Robust Transcript Discovery and Quantification

  • marina-yarberry
  • 27 Slides

Seq. Ion . Mandoiu. , Alex . Zelikovsky. , . Serg...

X-Shaped Radio Galaxies and the Gravitational Wave Backgrou

X-Shaped Radio Galaxies and the Gravitational Wave Backgrou

  • jane-oiler
  • 51 Slides

David Roberts, Jake Cohen, & Jing Lu. Brandei...

Young Radio

Young Radio

  • alida-meadow
  • 24 Slides

S. ources associated with. Broad Absorption L...

Fraction of galaxies of different types plotted as function

Fraction of galaxies of different types plotted as function

  • yoshiko-marsland
  • 25 Slides

Galaxy Morphology and Environment. Main relation ...

GNUMap

GNUMap

  • stefany-barnette
  • 24 Slides

:. . Unbiased Probabilistic Mapping of Next-Gene...

Genome Rearrangements:

Genome Rearrangements:

  • lindy-dunigan
  • 139 Slides

from Biological . Problem to . Combinatorial Algo...

Genome Rearrangements

Genome Rearrangements

  • sherrill-nordquist
  • 64 Slides

Basic Biology: DNA. Genetic information is stored...

U ser Research,

U ser Research,

  • pasty-toler
  • 62 Slides

Project Pitches and Brainstorming. CS 5115. Fall ...

Astronomy 1 –

Astronomy 1 –

  • debby-jeon
  • 70 Slides

Fall 2014. Lecture . 16; December 8, 2014. Previ...

Positional cloning:

Positional cloning:

  • test
  • 69 Slides

the rest of the story. http://faculty.ithaca.edu/...

Genome mapping

Genome mapping

  • natalia-silvester
  • 42 Slides

Genome sequencing. Next Gen sequencing. Genomics ...

Quantifying contributions of mutations and homologous reco

Quantifying contributions of mutations and homologous reco

  • danika-pritchard
  • 55 Slides

genomic . diversity. Sergei . Maslov. Department ...

Biggest

Biggest

  • alexa-scheidler
  • 19 Slides

Ever . Maths. and Science Lesson. Investigating ...

Douglas

Douglas

  • phoebe-click
  • 38 Slides

Hanahan. , Robert A. Weinberg . Hallmarks...

Hubble's 25th Anniversary:  Hubble's Views of Star and Clu

Hubble's 25th Anniversary:  Hubble's Views of Star and Clu

  • alexa-scheidler
  • 27 Slides

Drs. Carol Christian, Antonella Nota, and Brad Wh...

Astronomy 1 –

Astronomy 1 –

  • luanne-stotts
  • 63 Slides

Fall 2014. . Lecture . 15; December 4, . 2014. P...

Gravitational

Gravitational

  • myesha-ticknor
  • 43 Slides

Redshift. in Clusters of Galaxies. Marton Trencse...

Cluster views of the high redshift universe

Cluster views of the high redshift universe

  • tatiana-dople
  • 23 Slides

Leonidas . Moustakas. , JPL/Caltech. CLASH London...

Stellar-mass

Stellar-mass

  • mitsue-stanley
  • 23 Slides

Metallicity. Relation at High . Redshifts. Stell...

GRBs as cosmological probes

GRBs as cosmological probes

  • lois-ondreau
  • 33 Slides

Thomas Krühler (DARK). Thanks to J. . Fynbo. , D...

Feeding the Giants, 2011

Feeding the Giants, 2011

  • lois-ondreau
  • 25 Slides

GRBs. in the era of . ELTs. Nial . Tanvir. Unive...

relationship must be calibrated in units of L by measuring abs

relationship must be calibrated in units of L by measuring abs

  • pamella-moone
  • 100 Slides

486.1500.90.03049120H#434.1 Observed from MWObserv...

lecture 10 Previous Supernovae observed in our Galaxy A supernova expl

lecture 10 Previous Supernovae observed in our Galaxy A supernova expl

  • danika-pritchard
  • 100 Slides

rotates 30 times per second. Hot gas is pulled tow...

Noninvasive assessment of the fetal genome is now possible using next-

Noninvasive assessment of the fetal genome is now possible using next-

  • liane-varnes
  • 100 Slides

Genet MedGenetics in Medicine10.1038/gim.2013.29AC...

How I learne

How I learne

  • celsa-spraggs
  • 19 Slides

d to quit worrying. Deanna M. Church . Staff Scie...

Repetitive DNA and next-generation sequencing: computationa

Repetitive DNA and next-generation sequencing: computationa

  • pamella-moone
  • 21 Slides

Chen . Bichao. TJ . Treangen. , SL . Salzberg. ...

Crosslink

Crosslink

  • karlyn-bohler
  • 13 Slides

Y. Lyse & Sonicate. IP. Reverse crosslinks. T...

Introduction to epigenetics: chromatin modifications, DNA m

Introduction to epigenetics: chromatin modifications, DNA m

  • tatiana-dople
  • 45 Slides

CpG. Island landscape. Héctor. Corrada Bravo. ...

User Guide v2.0

User Guide v2.0

  • liane-varnes
  • 7 Slides

Mutual Retail Mode Connection Guide. SAMSUNG ELEC...

In latent infection- retroviral genome is present but is no

In latent infection- retroviral genome is present but is no

  • stefany-barnette
  • 7 Slides

Distinguished by qPCR (DNA) and qRT-PCR (RNA). Re...

Retroviruses and the RW Genome –

Retroviruses and the RW Genome –

  • tatyana-admore
  • 14 Slides

Active Roles in Evolution of . Immunity and Pregn...

Welcome to Social Studies!!!

Welcome to Social Studies!!!

  • tawny-fly
  • 16 Slides

Ms. Kennedy. 386-259-8066. vekenned@volusia.k12.f...

Extending the Galaxy portal with parallel and distributed e

Extending the Galaxy portal with parallel and distributed e

  • liane-varnes
  • 25 Slides

Ketan Maheshwari. , Alex Rodriguez, David Kelly, ...

Fast, flexible, comprehensive genome annotation on demandPEDANT™

Fast, flexible, comprehensive genome annotation on demandPEDANT™

  • faustina-dinatale
  • 100 Slides

Turn sequence data into knowledgeThe PEDANT™ ...

Copyright © 2024 DocSlides. All Rights Reserved