Search Results for 'gene data'

gene data published presentations and documents on DocSlides.

Jennifer Layden, MD, PhD

Jennifer Layden, MD, PhD

by olivia-moreira

Jennifer Layden, MD, PhD Assistant Professor of M...

Tools and Algorithms in

Tools and Algorithms in

by faustina-dinatale

Bioinformatics. GCBA815/MCGB815/BMI815, Fall 2017...

Introduction to G-OnRamp

Introduction to G-OnRamp

by aaron

From Galaxy to Genome Annotation. Jeremy . Goecks...

James Lindsay 1 Caroline Jakuba

James Lindsay 1 Caroline Jakuba

by pasty-toler

2. Ion mandoiu. 1. Craig Nelson. 2. Gene Expressi...

Protein-protein Interactions

Protein-protein Interactions

by faustina-dinatale

June 12, 2018. Why PPI?. Protein-protein interact...

BF528 - Biological Data Formats

BF528 - Biological Data Formats

by alexa-scheidler

02/14/2018. Introduction. There are different typ...

Breeding Bunnies Lab Problem: What happens to the frequency of harmful recessive genes during evol

Breeding Bunnies Lab Problem: What happens to the frequency of harmful recessive genes during evol

by lois-ondreau

Background: . F—allele for fur (dominant). ...

Sequencing, de novo assembling, and annotating the genome of the endangered Chinese crocodile liz

Sequencing, de novo assembling, and annotating the genome of the endangered Chinese crocodile liz

by aaron

shinisaurus. . crocodilurus. Jian . gao. , . qiy...

Are All Dogs the Same? Dog Genome Project

Are All Dogs the Same? Dog Genome Project

by cheryl-pisano

Wayne & Ostrander 2007. Why dogs?. Important ...

VIOLIN and VO (Vaccine Ontology)

VIOLIN and VO (Vaccine Ontology)

by phoebe-click

Yongqun. . “Oliver” He. Unit for Laboratory ...

1 Massively Parallel Genomic Sequence Search on Blue Gene/P

1 Massively Parallel Genomic Sequence Search on Blue Gene/P

by karlyn-bohler

Heshan Lin. (NCSU). Pavan Balaji (ANL). Ruth P...

Application of available statistical tools

Application of available statistical tools

by calandra-battersby

Development of specific, more appropriate statist...

Nuevas perspectivas en análisis

Nuevas perspectivas en análisis

by danika-pritchard

genomico. : implicaciones del proyecto ENCODE. 1....

by sherrill-nordquist

Arjan. van . Zeijl. . Claire . Lessa. . Alvim....

Utilizing a Concept Inventory to Facilitate Data-Driven Cou

Utilizing a Concept Inventory to Facilitate Data-Driven Cou

by sherrill-nordquist

Heather Seitz, Ph. D.. Associate Professor of Mi...

Canadian Bioinformatics Workshops

Canadian Bioinformatics Workshops

by stefany-barnette

www.bioinformatics.ca. 2. Module #: Title of Modu...

Genomics in Tree Breeding and Forest Ecosystem Management

Genomics in Tree Breeding and Forest Ecosystem Management

by calandra-battersby

-----. Module . 11 . – . Association Genetics. ...

by marina-yarberry

-related models in Drosophila. ADRC 2014, San Die...

Help: Strain Page Header

Help: Strain Page Header

by sherrill-nordquist

Yeast ORF deletion:. _d suffix : dubious ORF. _p ...

Measuring transcriptomes with

Measuring transcriptomes with

by stefany-barnette

RNA-. seq. BMI 877. Spring . 2017. Colin Dewey. c...

ATGTTCTATCCCATTCATTTTGACGTTATTGTTGTTGGAGGAGGTCATGCTGGGACAGA

ATGTTCTATCCCATTCATTTTGACGTTATTGTTGTTGGAGGAGGTCATGCTGGGACAGA

by pasty-toler

DNA sequencing. Why? . – Identifies . Organisms...

GSEA-Pro Tutorial

GSEA-Pro Tutorial

by pasty-toler

Anne de Jong. University of Groningen. Introducti...

by faustina-dinatale

: A Web . A. pplication for Visualizing . M. odel...

by briana-ranney

Bioinformatics . Workshop:. RNA . Seq. using Gal...

Help: Strain Page Header

Help: Strain Page Header

by calandra-battersby

Yeast ORF deletion:. _d suffix : dubious ORF. _p ...

by stefany-barnette

analysis using . TCGA . HNSC data. Vinay. . Kar...

TECHNICAL REPORT Exploring the Use of Main Memory Database MMDB Technology for the Analysis of Gene Expression Microarray Data Prepared by Nicholas Carriero PhD Michael V

TECHNICAL REPORT Exploring the Use of Main Memory Database MMDB Technology for the Analysis of Gene Expression Microarray Data Prepared by Nicholas Carriero PhD Michael V

by liane-varnes

Osier PhD KeiHoi Cheung PhD 3 Peter Masiar MS Per...

Supplementary data Characterization and phylogenetic analysis of gliadin gene sequences reveals signicant genomic divergence in Triticeae species GuangRong Li Tao Lang EnNian Yang Cheng Liu and ZuJun

Supplementary data Characterization and phylogenetic analysis of gliadin gene sequences reveals signicant genomic divergence in Triticeae species GuangRong Li Tao Lang EnNian Yang Cheng Liu and ZuJun

by kittie-lecroy

Genet 93 725731 Table 1 The gliadin gene sequen...

Hands-on Tutorial:

Hands-on Tutorial:

by stefany-barnette

RNA-. seq. Analysis using Cluster Computing. NYU...

by lois-ondreau

. RNASeq. Pipeline. Steve Searle. Outline of Ta...

by lindy-dunigan

-related models in Drosophila. ADRC 2014, San Die...

by tawny-fly

Evolutionary History with Network Models in Popul...

by jane-oiler

Borodovsky. . a short intro . Position open:. ...

Look at the two datasets

Look at the two datasets

by natalia-silvester

what are they doing. Network-based classification...

ProQuct Data Sheet

ProQuct Data Sheet

by danika-pritchard

ProQuct HighlightsHighlycurated3fficientCost-effec...

A concise gene and protein repositoryPedant-Pro™ Sequence Analysi

A concise gene and protein repositoryPedant-Pro™ Sequence Analysi

by ellena-manuel

Turn sequence data into knowledgeIn times of expon...

by faustina-dinatale

A (soon to be outdated) Tutorial. A Brief History...

by test

HORT6033. Molecular . Plant . B. reeding. Instruc...

Searching for Transcription Start Sites in

Searching for Transcription Start Sites in

by marina-yarberry

Drosophila. 06/2016. Wilson Leung. Outline. Trans...

Identification of

Identification of

by kittie-lecroy

obesity-associated . intergenic long noncoding . ...