Explore
Upload

DocSlides is a free service to upload presentations and documents.

Upload Now

Search Results for 'Cell Genome'

Cell Genome published presentations and documents on DocSlides.

Purposes and features

Purposes and features

  • lois-ondreau
  • 37 Slides

Browse genes in their genomic context.. See featu...

Governance, Regulation, and Control:

Governance, Regulation, and Control:

  • celsa-spraggs
  • 17 Slides

Of Which People, By Which People, For Which Peopl...

A high-resolution map of human evolutionary constraints usi

A high-resolution map of human evolutionary constraints usi

  • trish-goza
  • 27 Slides

Kerstin . Lindblad-. Toh. . et al. . 2011. Prese...

Detecting selection using genome scans

Detecting selection using genome scans

  • ellena-manuel
  • 36 Slides

Roger Butlin. University of Sheffield. Nielsen R....

Viral Evolution in

Viral Evolution in

  • ellena-manuel
  • 21 Slides

Endosymbionts. February 11, . 2012. Seth Bordenst...

TGCAAACTCAAACTCTTTTGTTGTTCTTACTGTATCATTGCCCAGAATAT

TGCAAACTCAAACTCTTTTGTTGTTCTTACTGTATCATTGCCCAGAATAT

  • olivia-moreira
  • 43 Slides

TCTGCCTGTCTTTAGAGGCTAATACATTGATTAGTGAATTCCAATGGGC...

Web-based analysis of (epi-) genome data using EpiGRAPH and Christoph

Web-based analysis of (epi-) genome data using EpiGRAPH and Christoph

  • pamella-moone
  • 100 Slides

http://galaxyproject.org/ for genome and epigenome...

The Autism Genome Project and Genocide

The Autism Genome Project and Genocide

  • danika-pritchard
  • 23 Slides

The Unbearable Uncertainty of Being (Autistic). P...

Analysis of Next Generation Sequence Data

Analysis of Next Generation Sequence Data

  • luanne-stotts
  • 53 Slides

BIOST 2055. 04/06/2015. Last Lecture . Genome-wid...

Presenting:

Presenting:

  • karlyn-bohler
  • 29 Slides

On the immortality of television sets: “functio...

Vibrio

Vibrio

  • luanne-stotts
  • 40 Slides

genome analysis. Christina. Isabella. Roland. Sa...

Last lecture summary

Last lecture summary

  • briana-ranney
  • 37 Slides

Sequencing strategies. Hierarchical genome shotgu...

P řednáška 13. 3. odpadá

P řednáška 13. 3. odpadá

  • sherrill-nordquist
  • 34 Slides

Last lecture summary. recombinant DNA technology....

How do Replication and Transcription Change Genomes?

How do Replication and Transcription Change Genomes?

  • conchita-marotz
  • 34 Slides

Andrey Grigoriev. Director, Center for Computatio...

The Pines

The Pines

  • tawny-fly
  • 109 Slides

October 28, . 2013. Genomic Medicine. Malcolm Cam...

Denovo

Denovo

  • olivia-moreira
  • 39 Slides

genome assembly . and analysis. outline. De novo...

Predicting Genes in Mycobacteriophages

Predicting Genes in Mycobacteriophages

  • phoebe-click
  • 42 Slides

December . 8. , 2014. 2014 In . S. ilico. Worksh...

“An

“An

  • trish-goza
  • 42 Slides

integrated encyclopedia of DNA elements in the hu...

Outline

Outline

  • min-jolicoeur
  • 62 Slides

Whole Genome Assembly. How it works. How to make ...

Sequencing extinct human ancestors

Sequencing extinct human ancestors

  • kittie-lecroy
  • 27 Slides

Credits to Vanessa Patel for some of the slides. ...

Improving RAST annotations within RAST

Improving RAST annotations within RAST

  • tatiana-dople
  • 16 Slides

Veronika Vonstein. Fellowship for Interpretation ...

University of Connecticut

University of Connecticut

  • min-jolicoeur
  • 1 Slides

School of Engineering. Assembler. Reference. Abys...

Jeri Dilts

Jeri Dilts

  • karlyn-bohler
  • 38 Slides

Suzanna Kim. Hema Nagrajan. Deepak Purushotham. A...

Genomics and Personalized Care in Health Systems

Genomics and Personalized Care in Health Systems

  • lois-ondreau
  • 45 Slides

Lecture 5 Genome Browser. Leming Zhou, PhD. Schoo...

Sequence Comparison and

Sequence Comparison and

  • cheryl-pisano
  • 37 Slides

Genome Alignment in the Human Genome. Jian. Ma....

Fast and accurate short read alignment with Burrows–Wheel

Fast and accurate short read alignment with Burrows–Wheel

  • danika-pritchard
  • 22 Slides

transform. Heng. Li and Richard Durbin∗. Membe...

The exam was written based on 100 points. Dr. Cline will w

The exam was written based on 100 points. Dr. Cline will w

  • danika-pritchard
  • 9 Slides

Important . – please keep your answers short; c...

cs3102: Theory of Computation

cs3102: Theory of Computation

  • marina-yarberry
  • 59 Slides

Class 26: . NP-Complete Entr. é. es. (DNA with a...

Sorting by Cuts, Joins and Whole Chromosome Duplications

Sorting by Cuts, Joins and Whole Chromosome Duplications

  • alexa-scheidler
  • 33 Slides

Ron Zeira. and Ron Shamir. Combinatorial Pattern...

Genomes and their evolution

Genomes and their evolution

  • stefany-barnette
  • 13 Slides

Chapter 21. You must know. How prokaryotic genome...

The impact of next-generation sequencing technology of gene

The impact of next-generation sequencing technology of gene

  • sherrill-nordquist
  • 37 Slides

Elaine R. . Mardis. – 11 . February. . 2008. W...

GEP Curriculum for Beginning STEM Majors

GEP Curriculum for Beginning STEM Majors

  • alexa-scheidler
  • 16 Slides

GEP Alumni Consortium. NSF Improving Undergraduat...

Dr G P S Raghava, Head Bioinformatics Centre

Dr G P S Raghava, Head Bioinformatics Centre

  • conchita-marotz
  • 41 Slides

Institute of Microbial Technology, Chandigarh, In...

Assembly and Annotation of a 22Gb

Assembly and Annotation of a 22Gb

  • tatiana-dople
  • 68 Slides

C. onifer . G. enome, Loblolly Pine. Jill Wegrzyn...

Riann

Riann

  • briana-ranney
  • 25 Slides

. Egusquiza. D145 Presentation. January 12, 2017...

Molecular Biology of Cancer AND

Molecular Biology of Cancer AND

  • mitsue-stanley
  • 52 Slides

Cancer Informatics (omics). David Boone. Outline....

Working Group Meeting

Working Group Meeting

  • tawny-fly
  • 48 Slides

February 29, 2016. 1. 888-844-9904. passcode . 2...

Dr. George Church

Dr. George Church

  • tatiana-dople
  • 23 Slides

Professor,. . Department of Genetics. Harvard Me...

Genome Read In-Memory (GRIM) Filter:

Genome Read In-Memory (GRIM) Filter:

  • faustina-dinatale
  • 1 Slides

Fast Location Filtering in DNA Read Mapping using...

Global Variation in Copy Number

Global Variation in Copy Number

  • ellena-manuel
  • 18 Slides

in the Human Genome. Redon et. al.. Presentation ...

Copyright © 2024 DocSlides. All Rights Reserved