Explore
Upload

DocSlides is a free service to upload presentations and documents.

Upload Now

Search Results for 'Cas9 Genome'

Cas9 Genome published presentations and documents on DocSlides.

IMPRS workshop

IMPRS workshop

  • alexa-scheidler
  • 49 Slides

Comparative Genomics. 18. th. -21. st. of Februa...

The IWGSC:

The IWGSC:

  • briana-ranney
  • 36 Slides

Strategies & Activities to Sequence the Bread...

Polysaccharide A

Polysaccharide A

  • olivia-moreira
  • 15 Slides

a. widely distributed . immunoregulatory. micro...

Getting Started with IGV

Getting Started with IGV

  • pasty-toler
  • 81 Slides

Programming for Biology 2015. Madelaine Gogol. Pr...

BIO 508

BIO 508

  • phoebe-click
  • 96 Slides

Comparative Genomics. Eric Franzosa, PhD. 2 April...

Purposes and features

Purposes and features

  • lois-ondreau
  • 37 Slides

Browse genes in their genomic context.. See featu...

Governance, Regulation, and Control:

Governance, Regulation, and Control:

  • celsa-spraggs
  • 17 Slides

Of Which People, By Which People, For Which Peopl...

ENCODE 2012

ENCODE 2012

  • conchita-marotz
  • 19 Slides

The Human Genome project sequenced “the human g...

A high-resolution map of human evolutionary constraints usi

A high-resolution map of human evolutionary constraints usi

  • trish-goza
  • 27 Slides

Kerstin . Lindblad-. Toh. . et al. . 2011. Prese...

Detecting selection using genome scans

Detecting selection using genome scans

  • ellena-manuel
  • 36 Slides

Roger Butlin. University of Sheffield. Nielsen R....

Viral Evolution in

Viral Evolution in

  • ellena-manuel
  • 21 Slides

Endosymbionts. February 11, . 2012. Seth Bordenst...

TGCAAACTCAAACTCTTTTGTTGTTCTTACTGTATCATTGCCCAGAATAT

TGCAAACTCAAACTCTTTTGTTGTTCTTACTGTATCATTGCCCAGAATAT

  • olivia-moreira
  • 43 Slides

TCTGCCTGTCTTTAGAGGCTAATACATTGATTAGTGAATTCCAATGGGC...

Web-based analysis of (epi-) genome data using EpiGRAPH and Christoph

Web-based analysis of (epi-) genome data using EpiGRAPH and Christoph

  • pamella-moone
  • 100 Slides

http://galaxyproject.org/ for genome and epigenome...

The Autism Genome Project and Genocide

The Autism Genome Project and Genocide

  • danika-pritchard
  • 23 Slides

The Unbearable Uncertainty of Being (Autistic). P...

Analysis of Next Generation Sequence Data

Analysis of Next Generation Sequence Data

  • luanne-stotts
  • 53 Slides

BIOST 2055. 04/06/2015. Last Lecture . Genome-wid...

BE/APh161 – Physical Biology of the Cell

BE/APh161 – Physical Biology of the Cell

  • tatiana-dople
  • 18 Slides

Rob Phillips. Applied Physics and Bioengineering....

Presenting:

Presenting:

  • karlyn-bohler
  • 29 Slides

On the immortality of television sets: “functio...

Vibrio

Vibrio

  • luanne-stotts
  • 40 Slides

genome analysis. Christina. Isabella. Roland. Sa...

Last lecture summary

Last lecture summary

  • briana-ranney
  • 37 Slides

Sequencing strategies. Hierarchical genome shotgu...

P řednáška 13. 3. odpadá

P řednáška 13. 3. odpadá

  • sherrill-nordquist
  • 34 Slides

Last lecture summary. recombinant DNA technology....

How do Replication and Transcription Change Genomes?

How do Replication and Transcription Change Genomes?

  • conchita-marotz
  • 34 Slides

Andrey Grigoriev. Director, Center for Computatio...

The Pines

The Pines

  • tawny-fly
  • 109 Slides

October 28, . 2013. Genomic Medicine. Malcolm Cam...

Denovo

Denovo

  • olivia-moreira
  • 39 Slides

genome assembly . and analysis. outline. De novo...

Predicting Genes in Mycobacteriophages

Predicting Genes in Mycobacteriophages

  • phoebe-click
  • 42 Slides

December . 8. , 2014. 2014 In . S. ilico. Worksh...

ENCODE 2012

ENCODE 2012

  • test
  • 21 Slides

The Human Genome project sequenced “the human g...

Practical Guide to the (mod)ENCODE project

Practical Guide to the (mod)ENCODE project

  • mitsue-stanley
  • 46 Slides

February . 27 2013. Fundamental Goals. Improve co...

“An

“An

  • trish-goza
  • 42 Slides

integrated encyclopedia of DNA elements in the hu...

Cells

Cells

  • stefany-barnette
  • 13 Slides

Are we done yet?. Answer: Almost.. What do we nee...

Virus Life Cycles in 3D

Virus Life Cycles in 3D

  • olivia-moreira
  • 42 Slides

The Art of Reconstruction. In order to survive, v...

Outline

Outline

  • min-jolicoeur
  • 62 Slides

Whole Genome Assembly. How it works. How to make ...

Sequencing extinct human ancestors

Sequencing extinct human ancestors

  • kittie-lecroy
  • 27 Slides

Credits to Vanessa Patel for some of the slides. ...

Improving RAST annotations within RAST

Improving RAST annotations within RAST

  • tatiana-dople
  • 16 Slides

Veronika Vonstein. Fellowship for Interpretation ...

University of Connecticut

University of Connecticut

  • min-jolicoeur
  • 1 Slides

School of Engineering. Assembler. Reference. Abys...

Jeri Dilts

Jeri Dilts

  • karlyn-bohler
  • 38 Slides

Suzanna Kim. Hema Nagrajan. Deepak Purushotham. A...

Genomics and Personalized Care in Health Systems

Genomics and Personalized Care in Health Systems

  • lois-ondreau
  • 45 Slides

Lecture 5 Genome Browser. Leming Zhou, PhD. Schoo...

Sequence Comparison and

Sequence Comparison and

  • cheryl-pisano
  • 37 Slides

Genome Alignment in the Human Genome. Jian. Ma....

Fast and accurate short read alignment with Burrows–Wheel

Fast and accurate short read alignment with Burrows–Wheel

  • danika-pritchard
  • 22 Slides

transform. Heng. Li and Richard Durbin∗. Membe...

The exam was written based on 100 points. Dr. Cline will w

The exam was written based on 100 points. Dr. Cline will w

  • danika-pritchard
  • 9 Slides

Important . – please keep your answers short; c...

cs3102: Theory of Computation

cs3102: Theory of Computation

  • marina-yarberry
  • 59 Slides

Class 26: . NP-Complete Entr. é. es. (DNA with a...

Sorting by Cuts, Joins and Whole Chromosome Duplications

Sorting by Cuts, Joins and Whole Chromosome Duplications

  • alexa-scheidler
  • 33 Slides

Ron Zeira. and Ron Shamir. Combinatorial Pattern...

Copyright © 2024 DocSlides. All Rights Reserved