Explore
Upload

DocSlides is a free service to upload presentations and documents.

Upload Now

Search Results for 'Accession Genome'

Accession Genome published presentations and documents on DocSlides.

Tech-Talk UCSC Genome Browser

Tech-Talk UCSC Genome Browser

  • arya
  • 4 Slides

December 2, 2019. Mustafa Albahrani. Talk’s part...

De Novo Assembly of Mitochondrial Genomes from Low Coverage Whole-Genome Sequencing Reads

De Novo Assembly of Mitochondrial Genomes from Low Coverage Whole-Genome Sequencing Reads

  • vivian
  • 26 Slides

Fahad Alqahtani and Ion Mandoiu. University of Con...

HandbookHelp Me Understand GeneticsThe Human Genome ProjectReprinted f

HandbookHelp Me Understand GeneticsThe Human Genome ProjectReprinted f

  • stefany-barnette
  • 8 Slides

Chapter 10The Human Genome ProjectTable of Content...

GASiC: Metagenomic abundance estimation and diagnostic

GASiC: Metagenomic abundance estimation and diagnostic

  • sherrill-nordquist
  • 20 Slides

testing on . species level. Martin Lindner. , Ber...

CRISPR bacon: a sizzling technique to generate genetically

CRISPR bacon: a sizzling technique to generate genetically

  • yoshiko-marsland
  • 13 Slides

DeMayo. FJ, Spencer TE. Jennifer Thornton. April...

On Genome Assembly

On Genome Assembly

  • karlyn-bohler
  • 23 Slides

Abhiram. Ranade. IIT Bombay. Genome. Constituent...

Genomics Virtual Lab:

Genomics Virtual Lab:

  • pamella-moone
  • 14 Slides

analyze . your data with a mouse click. Igor Maku...

Course Overview

Course Overview

  • luanne-stotts
  • 35 Slides

02-223 Personalized Medicine:. Understanding Your...

Budding Technologies and Budding Yeast

Budding Technologies and Budding Yeast

  • alida-meadow
  • 49 Slides

2012 HHMI Summer Workshop for High School Scienc...

Translating NGS Data into a Clinically Actionable Assay

Translating NGS Data into a Clinically Actionable Assay

  • danika-pritchard
  • 41 Slides

Elaine R. Mardis, Ph.D.. Professor of Genetics. C...

Where in a Genome Does DNA Replication Begin?

Where in a Genome Does DNA Replication Begin?

  • calandra-battersby
  • 62 Slides

Algorithmic Warm-Up. Phillip . Compeau. and Pave...

PineRefSeq

PineRefSeq

  • olivia-moreira
  • 20 Slides

: Conifer Reference Genome Sequencing. An Adaptiv...

DNA Interlude

DNA Interlude

  • phoebe-click
  • 12 Slides

Classwork. Introduce yourself to your neighbor. E...

Mapping NGS sequences to a reference genome

Mapping NGS sequences to a reference genome

  • debby-jeon
  • 18 Slides

Why?. Resequencing. studies (DNA). Structural va...

Introduction to Short

Introduction to Short

  • lindy-dunigan
  • 37 Slides

Read Sequencing . Analysis. Jim Noonan. GENE 760....

DNA Sequencing

DNA Sequencing

  • lois-ondreau
  • 49 Slides

Method to sequence longer regions. cut many times...

TGCAAACTCAAACTCTTTTGTTGTTCTTACTGTATCATTGCCCAGAATAT

TGCAAACTCAAACTCTTTTGTTGTTCTTACTGTATCATTGCCCAGAATAT

  • luanne-stotts
  • 45 Slides

TCTGCCTGTCTTTAGAGGCTAATACATTGATTAGTGAATTCCAATGGGC...

Software for Robust Transcript Discovery and Quantification

Software for Robust Transcript Discovery and Quantification

  • marina-yarberry
  • 27 Slides

Seq. Ion . Mandoiu. , Alex . Zelikovsky. , . Serg...

GNUMap

GNUMap

  • stefany-barnette
  • 24 Slides

:. . Unbiased Probabilistic Mapping of Next-Gene...

Biggest

Biggest

  • alexa-scheidler
  • 19 Slides

Ever . Maths. and Science Lesson. Investigating ...

Positional cloning:

Positional cloning:

  • test
  • 69 Slides

the rest of the story. http://faculty.ithaca.edu/...

Crosslink

Crosslink

  • karlyn-bohler
  • 13 Slides

Y. Lyse & Sonicate. IP. Reverse crosslinks. T...

In latent infection- retroviral genome is present but is no

In latent infection- retroviral genome is present but is no

  • stefany-barnette
  • 7 Slides

Distinguished by qPCR (DNA) and qRT-PCR (RNA). Re...

Vocabulary Study for “how to live a 100 years”

Vocabulary Study for “how to live a 100 years”

  • luanne-stotts
  • 28 Slides

superannuated. (adj.) old and therefore no longer...

Genetic Approaches to Rare Diseases:

Genetic Approaches to Rare Diseases:

  • alida-meadow
  • 28 Slides

What has worked and what may work for AHC. Erin L...

Genome mapping

Genome mapping

  • giovanna-bartolotta
  • 49 Slides

Genome sequencing. Next Gen sequencing. Genome ma...

Previous Lecture:

Previous Lecture:

  • liane-varnes
  • 44 Slides

Gene Expression . Next-Generation . DNA Sequencin...

EBI web resources II:

EBI web resources II:

  • celsa-spraggs
  • 51 Slides

Ensembl. and . InterPro. Yanbin Yin. Fall 2014. ...

Human Sequencing

Human Sequencing

  • natalia-silvester
  • 43 Slides

Stefano . Lise. Bioinformatics & Statistical ...

Proteogenomics

Proteogenomics

  • alexa-scheidler
  • 48 Slides

Kelly Ruggles, Ph.D. . Proteomics Informatics. We...

IMPRS workshop

IMPRS workshop

  • alexa-scheidler
  • 49 Slides

Comparative Genomics. 18. th. -21. st. of Februa...

The IWGSC:

The IWGSC:

  • briana-ranney
  • 36 Slides

Strategies & Activities to Sequence the Bread...

Polysaccharide A

Polysaccharide A

  • olivia-moreira
  • 15 Slides

a. widely distributed . immunoregulatory. micro...

Getting Started with IGV

Getting Started with IGV

  • pasty-toler
  • 81 Slides

Programming for Biology 2015. Madelaine Gogol. Pr...

BIO 508

BIO 508

  • phoebe-click
  • 96 Slides

Comparative Genomics. Eric Franzosa, PhD. 2 April...

Purposes and features

Purposes and features

  • lois-ondreau
  • 37 Slides

Browse genes in their genomic context.. See featu...

Governance, Regulation, and Control:

Governance, Regulation, and Control:

  • celsa-spraggs
  • 17 Slides

Of Which People, By Which People, For Which Peopl...

ENCODE 2012

ENCODE 2012

  • conchita-marotz
  • 19 Slides

The Human Genome project sequenced “the human g...

A high-resolution map of human evolutionary constraints usi

A high-resolution map of human evolutionary constraints usi

  • trish-goza
  • 27 Slides

Kerstin . Lindblad-. Toh. . et al. . 2011. Prese...

Detecting selection using genome scans

Detecting selection using genome scans

  • ellena-manuel
  • 36 Slides

Roger Butlin. University of Sheffield. Nielsen R....

Copyright © 2024 DocSlides. All Rights Reserved