Sbatch Xsede published presentations and documents on DocSlides.
Resources . Basic Usage. After your account is ac...
Jun Wang. . hcc.unl.edu. Outline of . Workshop3...
. Zhao. NESAP . Hack-a-thon. November 29, 2016, ...
Outline of . Workshop3. Overview . of Current HPC...
Aurora Clark, CIRC Director. Peter Mills, Computa...
Using Longleaf ITS Research Computing Karl Eklund...
Zhengji. Zhao. User Engagement Group . Cori KNL U...
Zhengji. Zhao. User Engagement Group . Hands-on V...
grep16CTACTAAGACGAGAAAGACCCT17R01fastqx0000R01Fora...
College of Natural Resource. Río Piedras Campus. ...
1. Part 1: . ChIP. -seq peak calling. Part 2. Anal...
ATM 419/563. Spring 2017. Fovell. 1. Goals. Start ...
Mark Reed . Lani Clough. Objectives. Intermediate....
1. Part 1: . ChIP. -seq peak calling. Part 2. Anal...
: . ssh. or OOD. Check your quota for home, users...
John Zaitseff, . March 2016. High Performance Com...
Outline. Introduction/Questions. Explain . user s...
Chris Fields. Genome Assembly | Saba Ghaffari | 20...
Jessica Holmes. 1. PowerPoint by Shayan Tabe Bordb...
Regulatory. . Genomics. | Saurabh . Sinha. | 2...
ATM 419. Spring 2016. Fovell. 1. RIP (Read-Interpo...
Simulation Based Study of a Diffusion MRI Process ...
Copyright © 2024 DocSlides. All Rights Reserved