Search Results for 'Sbatch Xsede'

Using HPC for Ansys CFX and Fluent

• lindy-dunigan
• 28 Slides

John Zaitseff, . March 2016. High Performance Com...

Using the BYU Supercomputers

• danika-pritchard
• 11 Slides

Resources . Basic Usage. After your account is ac...

Getting Started: XSEDE Comet

• natalia-silvester
• 17 Slides

. Shahzeb Siddiqui - sms5713@psu.edu. Software...

funded by the National Science Foundation

• trish-goza
• 16 Slides

Award #ACI-1445604. Jetstream - . A . self-provis...

HPC at HCC

• yoshiko-marsland
• 13 Slides

Jun Wang. . hcc.unl.edu. Outline of . Workshop3...

Working on UC Davis Bioinformatics Core Administrated Compu

• yoshiko-marsland
• 40 Slides

Outline. Introduction/Questions. Explain . user s...

Accelerating TauDEM as a Scalable

• tatiana-dople
• 31 Slides

Hydrological Terrain Analysis Service on XSEDE. 1...

Steve Leak, and Zhengji

• briana-ranney
• 65 Slides

. Zhao. NESAP . Hack-a-thon. November 29, 2016, ...

Give Your Data the Edge

• giovanna-bartolotta
• 11 Slides

A Scalable Data Delivery Platform. University of ...

HPC at HCC Jun Wang hcc.unl.edu

• mitsue-stanley
• 0 Slides

Outline of . Workshop3. Overview . of Current HPC...

FutureGrid Computing Testbed as a Service

• giovanna-bartolotta
• 0 Slides

for . Condo_of. _Condos. Internet 2 panel. April ...

Getting Started: XSEDE Comet

• liane-varnes
• 0 Slides

. Shahzeb Siddiqui - sms5713@psu.edu. Software...

FutureGrid Computing Testbed as a Service

• celsa-spraggs
• 0 Slides

Overview. July 3 2013. Geoffrey Fox for FutureGri...

Welcome to Kamiak 10/2/2017 Training Session

• trish-goza
• 0 Slides

Aurora Clark, CIRC Director. Peter Mills, Computa...

Using Longleaf ITS Research Computing Karl Eklund Sandeep

• calandra-battersby
• 60 Slides

Using Longleaf ITS Research Computing Karl Eklund...

State of CyberGIS Shaowen Wang

• dailyno
• 38 Slides

CyberInfrastructure and Geospatial Information Lab...

Introduction - The basics of compiling and running on KNL

• kaptainpositive
• 50 Slides

Zhengji. Zhao. User Engagement Group . Cori KNL U...

Running VASP on Cori KNL

• reportssuper
• 55 Slides

Zhengji. Zhao. User Engagement Group . Hands-on V...

• eurolsin
• 14 Slides

Award #ACI-1445604. Jetstream - . A . self-provisi...

CF14 EGI-XSEDE Workshop Session

• roberts
• 9 Slides

Tuesday, May 20. Helsinki, . Findland. Usecase. 2...

BioinformaticsCodeLornaEDrakeCodes18wererunusingbashcodeonCardi27Univ

• payton
• 6 Slides

grep16CTACTAAGACGAGAAAGACCCT17R01fastqx0000R01Fora...

UPR - Department of Biology

• cadie
• 31 Slides

College of Natural Resource. Río Piedras Campus. ...

Bacterial Genome Assembly

• nicole
• 33 Slides

Chris Fields. Genome Assembly | Saba Ghaffari | 20...

Introduction to RNA-Seq & Transcriptome Analysis

• cady
• 46 Slides

Jessica Holmes. 1. PowerPoint by Shayan Tabe Bordb...

Regulatory Genomics Lab Regulatory Genomics | Saurabh Sinha | 2021

• Dreamsicle
• 58 Slides

1. Part 1: . ChIP. -seq peak calling. Part 2. Anal...

Regulatory Genomics Lab Saurabh Sinha

• CutiePie
• 40 Slides

Regulatory. . Genomics. | Saurabh . Sinha. | 2...

NESIS estimates for the SOC case

• leah
• 19 Slides

ATM 419. Spring 2016. Fovell. 1. RIP (Read-Interpo...

Supercell storms: In-class demo and Experiment 3

• bitsy
• 32 Slides

ATM 419/563. Spring 2017. Fovell. 1. Goals. Start ...

XSEDE’s Campus Bridging

• garcia
• 15 Slides

Project. Jim Ferguson. National Institute for Comp...

Intermediate MATLAB ITS Research Computing

• adah
• 87 Slides

Mark Reed . Lani Clough. Objectives. Intermediate....

Regulatory Genomics Lab Regulatory Genomics  | Saurabh Sinha | 2023

• adah
• 61 Slides

1. Part 1: . ChIP. -seq peak calling. Part 2. Anal...

Access/log in to longleaf

• joanne
• 107 Slides

: . ssh. or OOD. Check your quota for home, users...

Scaling Condor on XSEDE for LIGO

• violet
• 28 Slides

Peter Couvares. Syracuse University. LIGO Scientif...

Welcome to the National Physical Laboratory

• isabella
• 19 Slides

Simulation Based Study of a Diffusion MRI Process ...