Explore
Featured
Recent
Articles
Topics
Login
Upload
Featured
Recent
Articles
Topics
Login
Upload
Search Results for 'Sbatch-Xsede'
Sbatch-Xsede published presentations and documents on DocSlides.
Getting Started: XSEDE Comet
by liane-varnes
. Shahzeb Siddiqui - sms5713@psu.edu. Software...
Getting Started: XSEDE Comet
by natalia-silvester
. Shahzeb Siddiqui - sms5713@psu.edu. Software...
XSEDE’s Campus Bridging
by garcia
Project. Jim Ferguson. National Institute for Comp...
Scaling Condor on XSEDE for LIGO
by violet
Peter Couvares. Syracuse University. LIGO Scientif...
Access/log in to longleaf
by joanne
: . ssh. or OOD. Check your quota for home, users...
Regulatory Genomics Lab Regulatory Genomics | Saurabh Sinha | 2023
by adah
1. Part 1: . ChIP. -seq peak calling. Part 2. Anal...
Intermediate MATLAB ITS Research Computing
by adah
Mark Reed . Lani Clough. Objectives. Intermediate....
Supercell storms: In-class demo and Experiment 3
by bitsy
ATM 419/563. Spring 2017. Fovell. 1. Goals. Start ...
Regulatory Genomics Lab Regulatory Genomics | Saurabh Sinha | 2021
by Dreamsicle
1. Part 1: . ChIP. -seq peak calling. Part 2. Anal...
UPR - Department of Biology
by cadie
College of Natural Resource. Río Piedras Campus. ...
BioinformaticsCodeLornaEDrakeCodes18wererunusingbashcodeonCardi27Univ
by payton
grep16CTACTAAGACGAGAAAGACCCT17R01fastqx0000R01Fora...
Running VASP on Cori KNL
by reportssuper
Zhengji. Zhao. User Engagement Group . Hands-on V...
Introduction - The basics of compiling and running on KNL
by kaptainpositive
Zhengji. Zhao. User Engagement Group . Cori KNL U...
Using Longleaf ITS Research Computing Karl Eklund Sandeep
by calandra-battersby
Using Longleaf ITS Research Computing Karl Eklund...
Welcome to Kamiak 10/2/2017 Training Session
by trish-goza
Aurora Clark, CIRC Director. Peter Mills, Computa...
HPC at HCC Jun Wang hcc.unl.edu
by mitsue-stanley
Outline of . Workshop3. Overview . of Current HPC...
Steve Leak, and Zhengji
by briana-ranney
. Zhao. NESAP . Hack-a-thon. November 29, 2016, ...
HPC at HCC
by yoshiko-marsland
Jun Wang. . hcc.unl.edu. Outline of . Workshop3...
Using the BYU Supercomputers
by danika-pritchard
Resources . Basic Usage. After your account is ac...
CF14 EGI-XSEDE Workshop Session
by roberts
Tuesday, May 20. Helsinki, . Findland. Usecase. 2...
by eurolsin
Award #ACI-1445604. Jetstream - . A . self-provisi...
State of CyberGIS Shaowen Wang
by dailyno
CyberInfrastructure and Geospatial Information Lab...
FutureGrid Computing Testbed as a Service
by celsa-spraggs
Overview. July 3 2013. Geoffrey Fox for FutureGri...
FutureGrid Computing Testbed as a Service
by giovanna-bartolotta
for . Condo_of. _Condos. Internet 2 panel. April ...
Give Your Data the Edge
by giovanna-bartolotta
A Scalable Data Delivery Platform. University of ...
Accelerating TauDEM as a Scalable
by tatiana-dople
Hydrological Terrain Analysis Service on XSEDE. 1...
funded by the National Science Foundation
by trish-goza
Award #ACI-1445604. Jetstream - . A . self-provis...
Welcome to the National Physical Laboratory
by isabella
Simulation Based Study of a Diffusion MRI Process ...
NESIS estimates for the SOC case
by leah
ATM 419. Spring 2016. Fovell. 1. RIP (Read-Interpo...
Regulatory Genomics Lab Saurabh Sinha
by CutiePie
Regulatory. . Genomics. | Saurabh . Sinha. | 2...
Introduction to RNA-Seq & Transcriptome Analysis
by cady
Jessica Holmes. 1. PowerPoint by Shayan Tabe Bordb...
Bacterial Genome Assembly
by nicole
Chris Fields. Genome Assembly | Saba Ghaffari | 20...
Working on UC Davis Bioinformatics Core Administrated Compu
by yoshiko-marsland
Outline. Introduction/Questions. Explain . user s...
Using HPC for Ansys CFX and Fluent
by lindy-dunigan
John Zaitseff, . March 2016. High Performance Com...
Load More...