Explore
Upload

DocSlides is a free service to upload presentations and documents.

Upload Now

Search Results for 'Germline Cell'

Germline Cell published presentations and documents on DocSlides.

Genomic/Genetic Testing Germline v Somatic testing and the importance of Molecular Tumor Boards

Genomic/Genetic Testing Germline v Somatic testing and the importance of Molecular Tumor Boards

  • lois-ondreau
  • 0 Slides

Ben Ho Park MD PhD. Johns Hopkins University. Fin...

Breakout session 1 Somatic-to-germline

Breakout session 1 Somatic-to-germline

  • unita
  • 16 Slides

testing . pathways. Format. Round table discussion...

Governance, Regulation, and Control:

Governance, Regulation, and Control:

  • celsa-spraggs
  • 17 Slides

Of Which People, By Which People, For Which Peopl...

Genetic testing in ovarian cancer

Genetic testing in ovarian cancer

  • BlueEyedBeauty
  • 17 Slides

Dr Katie Snape. Joint Lead Consultant for Cancer G...

IntroductionKnowledge of spatial and temporal gene expression proles

IntroductionKnowledge of spatial and temporal gene expression proles

  • delilah
  • 13 Slides

We performed a genome-wide analysis of gene expres...

UTSW Cancer Genetics

UTSW Cancer Genetics

  • taylor
  • 2 Slides

CancerGenetics@utsouthwestern.edu | 214 - 645 - 25...

European Medicines Agency 7 Westferry Circus Canary Wharf London E1

European Medicines Agency 7 Westferry Circus Canary Wharf London E1

  • bery
  • 4 Slides

ICH Considerations General Principles to Address...

Why and how to test for germline

Why and how to test for germline

  • isabella2
  • 12 Slides

BRCA. mutations in Pancreatic Cancer. ESDO Learni...

U nknown genetic predisposition

U nknown genetic predisposition

  • lois-ondreau
  • 24 Slides

in familial breast cancer . . can . lie deep in ...

U nknown genetic predisposition

U nknown genetic predisposition

  • tatyana-admore
  • 31 Slides

in familial breast cancer . . can . lie deep in ...

tcacctcctgtagggcatct

tcacctcctgtagggcatct

  • tawny-fly
  • 4 Slides

▽. tggttgtttccaccttttgg. atgcatagtcacctttttga. ...

Nathan Krohne

Nathan Krohne

  • lois-ondreau
  • 10 Slides

Color Blindness. Discovery. John Dalton, an Engli...

State of the Art in BRCA

State of the Art in BRCA

  • ellena-manuel
  • 0 Slides

-Mutated Ovarian Cancer. This program will includ...

ASHG Workshop Classifying and Interpreting Germline and Somatic Variants in Your Large Cohort Stud

ASHG Workshop Classifying and Interpreting Germline and Somatic Variants in Your Large Cohort Stud

  • tatyana-admore
  • 0 Slides

Karchin Lab. Department of Biomedical Engineering...

Case Discussion: Second

Case Discussion: Second

  • celsa-spraggs
  • 0 Slides

Opinion. 55 year-old woman with . recurrent . ova...

Editorial governance in

Editorial governance in

  • mitsue-stanley
  • 0 Slides

germline. gene editing. Philip Campbell. Editor-...

Patient Selection for PARP

Patient Selection for PARP

  • sherrill-nordquist
  • 28 Slides

Inhibitors:. Purpose and Practicalities . Present...

Please note, these are the actual video-recorded

Please note, these are the actual video-recorded

  • blindnessinfluenced
  • 27 Slides

proceedings from the live CME event and may includ...

MIWI and MILI find small partnersTwo independent reports reveal the ex

MIWI and MILI find small partnersTwo independent reports reveal the ex

  • jones
  • 1 Slides

DOI:10.1038/nrg1908URLs RNA WORLD ORIGINAL RESEARC...

molecular

molecular

  • miller
  • 2 Slides

HEVA screen is a kit for the analysis of the ATM, ...

Human germline modification

Human germline modification

  • brianna
  • 30 Slides

Fatal genetic . d. isorders . No cure. 1 in 3 inf...

Human genome editing: ethics, engagement and governance

Human genome editing: ethics, engagement and governance

  • ella
  • 29 Slides

12 – 13 November 2019, Singapore. www.gfbr.globa...

Clinical Benefit of Integrative Genomic Profiling

Clinical Benefit of Integrative Genomic Profiling

  • ava
  • 21 Slides

in Advanced Solid Tumors. EDRN Biomarker Developme...

Cancer Registration in the Era of Genomics: Integrating Germline and Somatic Genetic Data into the

Cancer Registration in the Era of Genomics: Integrating Germline and Somatic Genetic Data into the

  • SoulfulDreamer
  • 20 Slides

Dr Fiona McRonald 11. th. June 2019. N...

Hereditary syndromes, genetic testing and

Hereditary syndromes, genetic testing and

  • Kingslayer
  • 55 Slides

gynaecological. cancers. Prof.. Nicoletta . Col...

proteins that can be engineered to induce a doublestrand break in a s

proteins that can be engineered to induce a doublestrand break in a s

  • obrien
  • 2 Slides

in animals such as rats the precise effects of gen...

Genomic Prostate Cancer Testing for Olaparib

Genomic Prostate Cancer Testing for Olaparib

  • abigail
  • 24 Slides

Laura Yarram-Smith . Solid Tumour Lead SWGLH. J...

Prudence in Germline Gene Editing

Prudence in Germline Gene Editing

  • rose
  • 20 Slides

The Urgent Need for Collaborative Partnerships in ...

Haem Genomics update Chris Wragg, Haematological Cancer Lead Scientist,

Haem Genomics update Chris Wragg, Haematological Cancer Lead Scientist,

  • ethlyn
  • 11 Slides

South West Genomic Laboratory Hub. 23. rd. Februa...

https://www.chemistryworld.com/news/study-claiming-gene-edited-babies-were-more-likely-to-die-young

https://www.chemistryworld.com/news/study-claiming-gene-edited-babies-were-more-likely-to-die-young

  • violet
  • 34 Slides

Ethics, governance and policy aspects of human gen...

Clare Turnbull, PhD FRCP

Clare Turnbull, PhD FRCP

  • ash
  • 32 Slides

FRCPath. MFPH MSc (Epidemiology). Professor in Tr...

“Mainstream” Genetic Consultation

“Mainstream” Genetic Consultation

  • ida
  • 3 Slides

Patient meets eligibility criteria as per . Nation...

Clinical interpretation of genomic variants

Clinical interpretation of genomic variants

  • trinity
  • 28 Slides

Harriet Feilotter, PhD, FCCMG, FACMG. Professor, D...

Readiness level of

Readiness level of

  • finley
  • 15 Slides

the. . Brazilian. . regulatory. framework: . ca...

A Comprehensive Review of p53 Mutations and Cancer Incidence in Companion Animals

A Comprehensive Review of p53 Mutations and Cancer Incidence in Companion Animals

  • mary
  • 14 Slides

Presented by: . Amit Levi. Class of 2022. Mentor:....

Supplemental Figure 2: Sanger Trace of Putative Germline FANCA S858R Variant

Supplemental Figure 2: Sanger Trace of Putative Germline FANCA S858R Variant

  • ava
  • 2 Slides

WGA AML. WGA AML. Skin. Skin. WGA GCT. WGA GCT. FA...

Screening of Genetic Variants in Familial Case of Myeloid Neoplasm Using Exome Sequencing

Screening of Genetic Variants in Familial Case of Myeloid Neoplasm Using Exome Sequencing

  • edolie
  • 28 Slides

State University of Campinas (UNICAMP). School of ...

National Childhood Cancer Registry

National Childhood Cancer Registry

  • walter434
  • 1 Slides

Long Term Outcomes of Children and Young Adults wi...

Copyright © 2025 DocSlides. All Rights Reserved