Explore
Upload

DocSlides is a free service to upload presentations and documents.

Upload Now

Search Results for 'Germline'

Germline published presentations and documents on DocSlides.

U nknown genetic predisposition

U nknown genetic predisposition

  • lois-ondreau
  • 24 Slides

in familial breast cancer . . can . lie deep in ...

Division and

Division and

  • lindy-dunigan
  • 10 Slides

Differentiation . in . Human . C. ells. Writing i...

Governance, Regulation, and Control:

Governance, Regulation, and Control:

  • celsa-spraggs
  • 17 Slides

Of Which People, By Which People, For Which Peopl...

U nknown genetic predisposition

U nknown genetic predisposition

  • tatyana-admore
  • 31 Slides

in familial breast cancer . . can . lie deep in ...

tcacctcctgtagggcatct

tcacctcctgtagggcatct

  • tawny-fly
  • 4 Slides

▽. tggttgtttccaccttttgg. atgcatagtcacctttttga. ...

Nathan Krohne

Nathan Krohne

  • lois-ondreau
  • 10 Slides

Color Blindness. Discovery. John Dalton, an Engli...

Experimental Medicine Trials of Promising HIV Candidates

Experimental Medicine Trials of Promising HIV Candidates

  • phoebe-click
  • 15 Slides

Robin Shattock. . Experimental . Medicine . Tria...

Human Germline Cycle

Human Germline Cycle

  • faustina-dinatale
  • 0 Slides

Specification . of Primordial Germ Cells. (PGCs) ...

State of the Art in BRCA

State of the Art in BRCA

  • ellena-manuel
  • 0 Slides

-Mutated Ovarian Cancer. This program will includ...

ASHG Workshop Classifying and Interpreting Germline and Somatic Variants in Your Large Cohort Stud

ASHG Workshop Classifying and Interpreting Germline and Somatic Variants in Your Large Cohort Stud

  • tatyana-admore
  • 0 Slides

Karchin Lab. Department of Biomedical Engineering...

Case Discussion: Second

Case Discussion: Second

  • celsa-spraggs
  • 0 Slides

Opinion. 55 year-old woman with . recurrent . ova...

Genomic/Genetic Testing Germline v Somatic testing and the importance of Molecular Tumor Boards

Genomic/Genetic Testing Germline v Somatic testing and the importance of Molecular Tumor Boards

  • lois-ondreau
  • 0 Slides

Ben Ho Park MD PhD. Johns Hopkins University. Fin...

Editorial governance in

Editorial governance in

  • mitsue-stanley
  • 0 Slides

germline. gene editing. Philip Campbell. Editor-...

The French Perspective The

The French Perspective The

  • sherrill-nordquist
  • 0 Slides

law. 1994. Civil code: . Art. 16-4. . <<. ...

Why ? And what are the current alternatives ?

Why ? And what are the current alternatives ?

  • natalia-silvester
  • 0 Slides

The Francis Crick Institute, London, UK. Moderato...

Gene Therapy In and Around the Germline

Gene Therapy In and Around the Germline

  • trish-goza
  • 0 Slides

Kyle Orwig. Magee-. Womens. Research Institute. ...

Patient Selection for PARP

Patient Selection for PARP

  • sherrill-nordquist
  • 28 Slides

Inhibitors:. Purpose and Practicalities . Present...

Please note, these are the actual video-recorded

Please note, these are the actual video-recorded

  • blindnessinfluenced
  • 27 Slides

proceedings from the live CME event and may includ...

MIWI and MILI find small partnersTwo independent reports reveal the ex

MIWI and MILI find small partnersTwo independent reports reveal the ex

  • jones
  • 1 Slides

DOI:10.1038/nrg1908URLs RNA WORLD ORIGINAL RESEARC...

molecular

molecular

  • miller
  • 2 Slides

HEVA screen is a kit for the analysis of the ATM, ...

Genomic Testing: When and Why?

Genomic Testing: When and Why?

  • callie
  • 11 Slides

Rob Finch, MS, CGC. Certified Genetic Counselor. M...

Human germline modification

Human germline modification

  • brianna
  • 30 Slides

Fatal genetic . d. isorders . No cure. 1 in 3 inf...

Human genome editing: ethics, engagement and governance

Human genome editing: ethics, engagement and governance

  • ella
  • 29 Slides

12 – 13 November 2019, Singapore. www.gfbr.globa...

Supplementary Fig . 1 (a)

Supplementary Fig . 1 (a)

  • hadly
  • 3 Slides

Phenotypic characteristics of caprine male germlin...

Clinical Benefit of Integrative Genomic Profiling

Clinical Benefit of Integrative Genomic Profiling

  • ava
  • 21 Slides

in Advanced Solid Tumors. EDRN Biomarker Developme...

Cancer Registration in the Era of Genomics: Integrating Germline and Somatic Genetic Data into the

Cancer Registration in the Era of Genomics: Integrating Germline and Somatic Genetic Data into the

  • SoulfulDreamer
  • 20 Slides

Dr Fiona McRonald 11. th. June 2019. N...

Genetic testing in ovarian cancer

Genetic testing in ovarian cancer

  • BlueEyedBeauty
  • 17 Slides

Dr Katie Snape. Joint Lead Consultant for Cancer G...

Hereditary syndromes, genetic testing and

Hereditary syndromes, genetic testing and

  • Kingslayer
  • 55 Slides

gynaecological. cancers. Prof.. Nicoletta . Col...

IntroductionKnowledge of spatial and temporal gene expression proles

IntroductionKnowledge of spatial and temporal gene expression proles

  • delilah
  • 13 Slides

We performed a genome-wide analysis of gene expres...

UTSW Cancer Genetics

UTSW Cancer Genetics

  • taylor
  • 2 Slides

CancerGenetics@utsouthwestern.edu | 214 - 645 - 25...

European Medicines Agency 7 Westferry Circus Canary Wharf London E1

European Medicines Agency 7 Westferry Circus Canary Wharf London E1

  • bery
  • 4 Slides

ICH Considerations General Principles to Address...

proteins that can be engineered to induce a doublestrand break in a s

proteins that can be engineered to induce a doublestrand break in a s

  • obrien
  • 2 Slides

in animals such as rats the precise effects of gen...

Hans-Willem Snoeck , Chair of the Columbia University Human Embryonic and Human Pluripotent Stem

Hans-Willem Snoeck , Chair of the Columbia University Human Embryonic and Human Pluripotent Stem

  • genevieve
  • 11 Slides

Deborah Stiles, Vice President for Research Operat...

Genomic Prostate Cancer Testing for Olaparib

Genomic Prostate Cancer Testing for Olaparib

  • abigail
  • 24 Slides

Laura Yarram-Smith . Solid Tumour Lead SWGLH. J...

Prudence in Germline Gene Editing

Prudence in Germline Gene Editing

  • rose
  • 20 Slides

The Urgent Need for Collaborative Partnerships in ...

Why and how to test for germline

Why and how to test for germline

  • isabella2
  • 12 Slides

BRCA. mutations in Pancreatic Cancer. ESDO Learni...

Haem Genomics update Chris Wragg, Haematological Cancer Lead Scientist,

Haem Genomics update Chris Wragg, Haematological Cancer Lead Scientist,

  • ethlyn
  • 11 Slides

South West Genomic Laboratory Hub. 23. rd. Februa...

https://www.chemistryworld.com/news/study-claiming-gene-edited-babies-were-more-likely-to-die-young

https://www.chemistryworld.com/news/study-claiming-gene-edited-babies-were-more-likely-to-die-young

  • violet
  • 34 Slides

Ethics, governance and policy aspects of human gen...

Clare Turnbull, PhD FRCP

Clare Turnbull, PhD FRCP

  • ash
  • 32 Slides

FRCPath. MFPH MSc (Epidemiology). Professor in Tr...

“Mainstream” Genetic Consultation

“Mainstream” Genetic Consultation

  • ida
  • 3 Slides

Patient meets eligibility criteria as per . Nation...

Copyright © 2024 DocSlides. All Rights Reserved