Explore
Upload

DocSlides is a free service to upload presentations and documents.

Upload Now

Search Results for 'Genome Species'

Genome Species published presentations and documents on DocSlides.

Bioinformatics for Whole-Genome Shotgun Sequencing of Micro

Bioinformatics for Whole-Genome Shotgun Sequencing of Micro

  • myesha-ticknor
  • 32 Slides

By Kevin Chen, . Lior. . Pachter. PLoS. Computa...

codingregiongenome

codingregiongenome

  • trish-goza
  • 33 Slides

Denovo genome Denovo genome outline outline novoge...

13.3- The Human Genome What is a genome?

13.3- The Human Genome What is a genome?

  • phoebe-click
  • 0 Slides

Genome: the total number of genes in an individua...

Issues with creating Genome Browsers for Whole Genome Assemblies

Issues with creating Genome Browsers for Whole Genome Assemblies

  • murphy
  • 39 Slides

G-OnRamp Beta Users Workshop. Wilson Leung. 07/201...

Developing genome

Developing genome

  • liane-varnes
  • 50 Slides

sequencing . for . identification,. detection, . ...

Prediction of effective genome size in metagenomics samples

Prediction of effective genome size in metagenomics samples

  • faustina-dinatale
  • 25 Slides

Jeroen. . Raes. , Jan O . Korbel. , Martin J . L...

IMPRS workshop

IMPRS workshop

  • alexa-scheidler
  • 49 Slides

Comparative Genomics. 18. th. -21. st. of Februa...

TGCAAACTCAAACTCTTTTGTTGTTCTTACTGTATCATTGCCCAGAATAT

TGCAAACTCAAACTCTTTTGTTGTTCTTACTGTATCATTGCCCAGAATAT

  • olivia-moreira
  • 43 Slides

TCTGCCTGTCTTTAGAGGCTAATACATTGATTAGTGAATTCCAATGGGC...

Conservation Genomics:

Conservation Genomics:

  • natalia-silvester
  • 25 Slides

An Introduction. By Jack Francis. May 2. nd. 201...

Comparative genomics

Comparative genomics

  • olivia-moreira
  • 24 Slides

Joachim Bargsten. February 2012. Comparative . ge...

Click to watch the 25 Genomes introductory video

Click to watch the 25 Genomes introductory video

  • mitsue-stanley
  • 0 Slides

DNA. Double helix. Bases. Sequence. Gene . Key wo...

Lecture 8 Mechanisms of Evolution: Genetic Variation - Horizontal Gene Transfer

Lecture 8 Mechanisms of Evolution: Genetic Variation - Horizontal Gene Transfer

  • adhesivedisney
  • 58 Slides

October 1, 2019. Jeremy . Glasner. PhD. Science, ...

Functional Plant Bioinformatics

Functional Plant Bioinformatics

  • candy
  • 21 Slides

Genes, gene families and genome organization. 21-2...

x0000x0000 2Combine evolutionary information wit

x0000x0000 2Combine evolutionary information wit

  • hailey
  • 13 Slides

�� ��...

Access to plant genome assemblies allows a better understanding of the diversity in plant species.

Access to plant genome assemblies allows a better understanding of the diversity in plant species.

  • tabitha
  • 1 Slides

complexity of some plants . (very high genome size...

Margret Grebowicz When Species Me t Margret Grebowicz When Species Me t Margret Grebowicz When Species Me t Margret Grebowicz When Species Me t Margret Grebowicz When Species Me t

Margret Grebowicz When Species Me t Margret Grebowicz When Species Me t Margret Grebowicz When Species Me t Margret Grebowicz When Species Me t Margret Grebowicz When Species Me t

  • liane-varnes
  • 17 Slides

envirolinkorgpipermailarnewsWeekofMon20030804 0047...

Genome size and Complexity

Genome size and Complexity

  • sherrill-nordquist
  • 22 Slides

(as told by Michael Lynch). Genome size and compl...

1 Genome sizes (sample)

1 Genome sizes (sample)

  • myesha-ticknor
  • 65 Slides

2. Some genomics history. 1995: first bacterial g...

Genome Rearrangements:

Genome Rearrangements:

  • lindy-dunigan
  • 139 Slides

from Biological . Problem to . Combinatorial Algo...

Genome Rearrangements

Genome Rearrangements

  • sherrill-nordquist
  • 64 Slides

Basic Biology: DNA. Genetic information is stored...

Genome mapping

Genome mapping

  • natalia-silvester
  • 42 Slides

Genome sequencing. Next Gen sequencing. Genomics ...

Retroviruses and the RW Genome –

Retroviruses and the RW Genome –

  • tatyana-admore
  • 14 Slides

Active Roles in Evolution of . Immunity and Pregn...

Genome Editing In the Clinic

Genome Editing In the Clinic

  • liane-varnes
  • 33 Slides

Fyodor D. Urnov, PhD. Project Leader and Senior S...

Genome Annotation

Genome Annotation

  • myesha-ticknor
  • 14 Slides

BCB 660. October 20, 2011. From Carson Holt. Anno...

A Comprehensive Workflow for Microbial Genome Sequencing

A Comprehensive Workflow for Microbial Genome Sequencing

  • mitsue-stanley
  • 5 Slides

From Swab to Publication. Madison I. Dunitz. 1. ,...

Genome sequencing and assembly

Genome sequencing and assembly

  • jane-oiler
  • 45 Slides

Mayo/UIUC Summer . C. ourse in Computational Biol...

Genome sequencing and assembly

Genome sequencing and assembly

  • tatiana-dople
  • 55 Slides

Mayo/UIUC Summer . C. ourse in Computational Biol...

Genome Browser

Genome Browser

  • pamella-moone
  • 100 Slides

The Plot. Deepak . Purushotham. Hamid Reza . Hass...

Genome Browsers

Genome Browsers

  • faustina-dinatale
  • 11 Slides

Genome Browser. Combines a genome database with i...

The Ashkenazi Genome Project

The Ashkenazi Genome Project

  • stefany-barnette
  • 48 Slides

Shai. Carmi. Pe’er. lab, Columbia University....

Environmental Genome Shotgun Sequencing of the Sargasso Sea

Environmental Genome Shotgun Sequencing of the Sargasso Sea

  • jane-oiler
  • 18 Slides

Venter et. al (2004). Presented by. Ken . Vittaya...

Learning the Rules of Genome Design

Learning the Rules of Genome Design

  • alexa-scheidler
  • 18 Slides

. John Glass. for members of the . Venter Instit...

3D Genome Workshop - Overview of ENCODE

3D Genome Workshop - Overview of ENCODE

  • luanne-stotts
  • 18 Slides

Dan Gilchrist. National Human Genome Research Ins...

Genome sequencing and assembly

Genome sequencing and assembly

  • aaron
  • 55 Slides

Mayo/UIUC Summer . C. ourse in Computational Biol...

Genome Editing In the Clinic

Genome Editing In the Clinic

  • phoebe-click
  • 31 Slides

Fyodor D. Urnov, PhD. Project Leader and Senior S...

Submitting a Genome to RAST

Submitting a Genome to RAST

  • lindy-dunigan
  • 6 Slides

Uploading Your Job. Login to your RAST account. Y...

Genome generation

Genome generation

  • alexa-scheidler
  • 17 Slides

Timetable for today. Time. Activity. 00:00. Intro...

The Integrated Microbial Genome (IMG) systems

The Integrated Microbial Genome (IMG) systems

  • conchita-marotz
  • 0 Slides

Nikos. . Kyrpides. Genome . Biology . Program (G...

Sequencing, de novo assembling, and annotating the genome of the endangered Chinese crocodile liz

Sequencing, de novo assembling, and annotating the genome of the endangered Chinese crocodile liz

  • aaron
  • 0 Slides

shinisaurus. . crocodilurus. Jian . gao. , . qiy...

Whole genome sequencing and comparative transcriptome analysis of a novel seawater adapted, salt-re

Whole genome sequencing and comparative transcriptome analysis of a novel seawater adapted, salt-re

  • pasty-toler
  • 0 Slides

Risheng. Chen et al. 2017. BMC Genomics. Oryza. ...

Copyright © 2024 DocSlides. All Rights Reserved