Explore
Upload

DocSlides is a free service to upload presentations and documents.

Upload Now

Search Results for 'Fastq Outdir'

Fastq Outdir published presentations and documents on DocSlides.

IMGS 2012

IMGS 2012

  • pamella-moone
  • 24 Slides

Bioinformatics Workshop:. File Formats for Next G...

Bioinformatics

Bioinformatics

  • briana-ranney
  • 44 Slides

. Analysis. Team . McGill . University. and . ...

FMR.fastq

FMR.fastq

  • giovanna-bartolotta
  • 1 Slides

FASTQ-to-FASTA. FASTQ/A Clipper. FASTQ/A . Collap...

Getting the computer setup

Getting the computer setup

  • myesha-ticknor
  • 27 Slides

Follow directions on handout to login to server.....

MCB3895-004 Lecture #11

MCB3895-004 Lecture #11

  • test
  • 19 Slides

Sept 30/14. De novo . genome assembly using Velve...

Use Case

Use Case

  • briana-ranney
  • 23 Slides

1: . Exogenous exRNA in plasma . of patients with...

Sequences and Alignment Format

Sequences and Alignment Format

  • conchita-marotz
  • 38 Slides

Galaxy overview and Interface. Getting Data in Ga...

Bioinformatics

Bioinformatics

  • lois-ondreau
  • 48 Slides

. Analysis. Team . McGill . University. and . ...

Bioinformatics

Bioinformatics

  • conchita-marotz
  • 46 Slides

. Analysis. Team . McGill . University. and . ...

RNA Seq:

RNA Seq:

  • faustina-dinatale
  • 36 Slides

A (soon to be outdated) Tutorial. A Brief History...

Assembly

Assembly

  • olivia-moreira
  • 32 Slides

Kristoffer H. Ring. INF-BIO5121. Task. 1.2 – ....

Elizabeth Tseng, Ph.D.

Elizabeth Tseng, Ph.D.

  • alexa-scheidler
  • 62 Slides

Staff Scientist. Iso-Seq. ™ Analysis & Beyo...

IMGS 2012

IMGS 2012

  • briana-ranney
  • 45 Slides

Bioinformatics . Workshop:. RNA . Seq. using Gal...

PDCB

PDCB

  • faustina-dinatale
  • 80 Slides

BioC. for HTS topic. Understanding the tech. . 0...

First Bite of Variant Calling in

First Bite of Variant Calling in

  • liane-varnes
  • 10 Slides

NGS/. MPS. Precourse. . materials. Yonglan Zheng...

Stubbs Lab Bioinformatics - 2

Stubbs Lab Bioinformatics - 2

  • kittie-lecroy
  • 17 Slides

Retrieving sequence data files. and. L. inux comm...

Analysis

Analysis

  • lindy-dunigan
  • 35 Slides

of B cell AIRR-. seq. . Data. Jason Anthony Vand...

Galaxy Hands-on Demo Step-by-step

Galaxy Hands-on Demo Step-by-step

  • olivia-moreira
  • 0 Slides

Yonglan Zheng. (yzheng3@uchicago.edu). 2017.6.10....

MGmapper A tool to map MetaGenomics

MGmapper A tool to map MetaGenomics

  • faustina-dinatale
  • 0 Slides

. data. 1. A tool to map . fastq. files against...

Use Case 1: Exogenous exRNA in plasma

Use Case 1: Exogenous exRNA in plasma

  • numeroenergy
  • 20 Slides

of patients with Colorectal Cancer . and Ulcerativ...

Sequence Quality Assessment

Sequence Quality Assessment

  • impristic
  • 14 Slides

Quality Assessment of Sequences. Why does quality ...

High Performance Computing for genomic applications Using genomic software on Euler

High Performance Computing for genomic applications Using genomic software on Euler

  • bikersnomercy
  • 17 Slides

Okoniewski. , Samuel . Fux. , Manuel Kohler. 11/22...

miccaDocumentationRelease1.7.0miccadevelopmentteamAug07,2018

miccaDocumentationRelease1.7.0miccadevelopmentteamAug07,2018

  • erica
  • 86 Slides

GettingStarted 1Install32Supporteddatabases73Paire...

Long-readDataAnalysisWorkshopDay1tutorials:PacBioassemblywithcommandli

Long-readDataAnalysisWorkshopDay1tutorials:PacBioassemblywithcommandli

  • jones
  • 37 Slides

Thu27-Fri28September2018UNSW,Sydney Contents1Gener...

BioinformaticsCodeLornaEDrakeCodes18wererunusingbashcodeonCardi27Univ

BioinformaticsCodeLornaEDrakeCodes18wererunusingbashcodeonCardi27Univ

  • payton
  • 6 Slides

grep16CTACTAAGACGAGAAAGACCCT17R01fastqx0000R01Fora...

Bacterial Genome Assembly

Bacterial Genome Assembly

  • nicole
  • 33 Slides

Chris Fields. Genome Assembly | Saba Ghaffari | 20...

BIO00076H: Sequence Analysis

BIO00076H: Sequence Analysis

  • BabyDoll
  • 38 Slides

Lecture 2. High-throughput sequencing Part 1. Kanc...

Discover our smart realtime assaysFastQ B27 150 M Bechterew et a

Discover our smart realtime assaysFastQ B27 150 M Bechterew et a

  • reese
  • 8 Slides

RT-PCR direct from blood! Your advantages Enjoy th...

Issues with creating Genome Browsers for Whole Genome Assemblies

Issues with creating Genome Browsers for Whole Genome Assemblies

  • murphy
  • 39 Slides

G-OnRamp Beta Users Workshop. Wilson Leung. 07/201...

Sequencing Data Quality Saulo

Sequencing Data Quality Saulo

  • ash
  • 28 Slides

. Aflitos. Read (≈100bp). Contig (≈2Kbp). Scaf...

Data Analysis Group Introduction to NGS

Data Analysis Group Introduction to NGS

  • roberts
  • 73 Slides

2. nd. August 2019. Sequencing history. Current s...

The FASTQ format and quality control

The FASTQ format and quality control

  • roy
  • 22 Slides

Bioinformatics and functional genomics. IMB Bioinf...

Bioinformatics : through the lens of COVID-19

Bioinformatics : through the lens of COVID-19

  • adia
  • 32 Slides

Dr. Lu Liu (. lu.liu.2@ndsu.edu. ). Department of ...

Copyright © 2024 DocSlides. All Rights Reserved