Search Results for 'Fastq-Outdir'

Fastq-Outdir published presentations and documents on DocSlides.

Long-readDataAnalysisWorkshopDay1tutorials:PacBioassemblywithcommandli
Long-readDataAnalysisWorkshopDay1tutorials:PacBioassemblywithcommandli
by jones
Thu27-Fri28September2018UNSW,Sydney Contents1Gener...
FMR.fastq
FMR.fastq
by giovanna-bartolotta
FASTQ-to-FASTA. FASTQ/A Clipper. FASTQ/A . Collap...
The FASTQ format and quality control
The FASTQ format and quality control
by roy
Bioinformatics and functional genomics. IMB Bioinf...
Data Analysis Group Introduction to NGS
Data Analysis Group Introduction to NGS
by roberts
2. nd. August 2019. Sequencing history. Current s...
Discover our smart realtime assaysFastQ B27 150 M Bechterew et a
Discover our smart realtime assaysFastQ B27 150 M Bechterew et a
by reese
RT-PCR direct from blood! Your advantages Enjoy th...
What is FastQC
What is FastQC
by josephine
FastQC 1. Intro duction 1.1 Modern high throughp...
miccaDocumentationRelease1.7.0miccadevelopmentteamAug07,2018
miccaDocumentationRelease1.7.0miccadevelopmentteamAug07,2018
by erica
GettingStarted 1Install32Supporteddatabases73Paire...
Sequence Quality Assessment
Sequence Quality Assessment
by impristic
Quality Assessment of Sequences. Why does quality ...
Use Case  1:  Exogenous exRNA in plasma
Use Case 1: Exogenous exRNA in plasma
by numeroenergy
of patients with Colorectal Cancer . and Ulcerativ...
Galaxy Hands-on Demo Step-by-step
Galaxy Hands-on Demo Step-by-step
by olivia-moreira
Yonglan Zheng. (yzheng3@uchicago.edu). 2017.6.10....
Stubbs Lab Bioinformatics - 2
Stubbs Lab Bioinformatics - 2
by kittie-lecroy
Retrieving sequence data files. and. L. inux comm...
Use Case
Use Case
by briana-ranney
1: . Exogenous exRNA in plasma . of patients with...
Assembly
Assembly
by olivia-moreira
Kristoffer H. Ring. INF-BIO5121. Task. 1.2 – ....
BioinformaticsCodeLornaEDrakeCodes18wererunusingbashcodeonCardi27Univ
BioinformaticsCodeLornaEDrakeCodes18wererunusingbashcodeonCardi27Univ
by payton
grep16CTACTAAGACGAGAAAGACCCT17R01fastqx0000R01Fora...
Bioinformatics : through the lens of COVID-19
Bioinformatics : through the lens of COVID-19
by adia
Dr. Lu Liu (. lu.liu.2@ndsu.edu. ). Department of ...
Moderní metody pro analýzu genomu: Bioinformatika I
Moderní metody pro analýzu genomu: Bioinformatika I
by mia
Vojtěch Bystrý. 29. . October. 2018. Goals of t...
Sequencing Data Quality Saulo
Sequencing Data Quality Saulo
by ash
. Aflitos. Read (≈100bp). Contig (≈2Kbp). Scaf...
Issues with creating Genome Browsers for Whole Genome Assemblies
Issues with creating Genome Browsers for Whole Genome Assemblies
by murphy
G-OnRamp Beta Users Workshop. Wilson Leung. 07/201...
BIO00076H:   Sequence Analysis
BIO00076H: Sequence Analysis
by BabyDoll
Lecture 2. High-throughput sequencing Part 1. Kanc...
Bacterial Genome Assembly
Bacterial Genome Assembly
by nicole
Chris Fields. Genome Assembly | Saba Ghaffari | 20...
High Performance Computing for genomic applications Using genomic software on Euler
High Performance Computing for genomic applications Using genomic software on Euler
by bikersnomercy
Okoniewski. , Samuel . Fux. , Manuel Kohler. 11/22...
MGmapper A tool to map  MetaGenomics
MGmapper A tool to map MetaGenomics
by faustina-dinatale
. data. 1. A tool to map . fastq. files against...
Analysis
Analysis
by lindy-dunigan
of B cell AIRR-. seq. . Data. Jason Anthony Vand...
First Bite of Variant Calling in
First Bite of Variant Calling in
by liane-varnes
NGS/. MPS. Precourse. . materials. Yonglan Zheng...
DATA and WORKFLOWS
DATA and WORKFLOWS
by celsa-spraggs
Data Life Cycle. Data Commons Repository (DCR), N...
PDCB
PDCB
by faustina-dinatale
BioC. for HTS topic. Understanding the tech. . 0...
IMGS 2012
IMGS 2012
by briana-ranney
Bioinformatics . Workshop:. RNA . Seq. using Gal...
IMGS 2012
IMGS 2012
by pamella-moone
Bioinformatics Workshop:. File Formats for Next G...
Bioinformatics
Bioinformatics
by briana-ranney
. Analysis. Team . McGill . University. and . ...
Getting the computer setup
Getting the computer setup
by myesha-ticknor
Follow directions on handout to login to server.....
MCB3895-004 Lecture #11
MCB3895-004 Lecture #11
by test
Sept 30/14. De novo . genome assembly using Velve...
Sequences and Alignment Format
Sequences and Alignment Format
by conchita-marotz
Galaxy overview and Interface. Getting Data in Ga...
Bioinformatics
Bioinformatics
by lois-ondreau
. Analysis. Team . McGill . University. and . ...
Bioinformatics
Bioinformatics
by conchita-marotz
. Analysis. Team . McGill . University. and . ...
RNA Seq:
RNA Seq:
by faustina-dinatale
A (soon to be outdated) Tutorial. A Brief History...
Elizabeth Tseng, Ph.D.
Elizabeth Tseng, Ph.D.
by alexa-scheidler
Staff Scientist. Iso-Seq. ™ Analysis & Beyo...