Explore
Featured
Recent
Articles
Topics
Login
Upload
Featured
Recent
Articles
Topics
Login
Upload
Search Results for '16s 2017'
16s 2017 published presentations and documents on DocSlides.
16S phylogeny of the
by reagan
. Streptomycetaceae. Alan Ward. Motivation. Strept...
Figure Figure. Chest computed tomography scan and sequencing of the 16S amplicon in a 77-year-old m
by eve
Moon J, Jang Y, Kim N, Park W, Park K, Lee S, et a...
analysis of Illumina MiSeq 16S rRNA gene amplicon data signifies the p
by briana-ranney
16S rRNA gene sequencing. Sequencing of material f...
Genetic diversity of
by tatiana-dople
Rhizobium. sp. in Russian Federation and Ukraine...
A Comprehensive Workflow for Microbial Genome Sequencing
by mitsue-stanley
From Swab to Publication. Madison I. Dunitz. 1. ,...
John C.F. Hsieh, MPH Bioinformatics and Computational Biology
by alexa-scheidler
PhD Candidate. June 11, 2018. Metagenomics Monday...
Figure 1 Figure 1. Neighbor-joining phylogenetic tree based on 16S rRNA gene sequence anal
by faith
Hall AJ, Cassiday PK, Bernard KA, Bolt F, Steigerw...
Figure 3 Figure 3. Phylogenetic tree showing the 16S rRNA relationships of our Clostridium
by rodriguez
Elsayed S, Zhang K. Human Infection Caused by Clos...
Integrating Data in a
by liane-varnes
Microbiome. Context. . Michael Shaffer. Catheri...
Practical Bioinformatics
by calandra-battersby
Community structure . measures for meta-genomics...
rapped dendograms of the mitochondrial 16S gene were constructed using
by faustina-dinatale
Xeneretmus leiops AY785299 Xeneretmus latifrons ...
Yan Wei Lim (San Diego State University)
by min-jolicoeur
Ann . Lesnefsky. (Stanford University). Sarah Do...
Bacterial chromosome
by calandra-battersby
16S . rRNA. gene. ". ". Primers. 16S . rRNA. ge...
Resolving microbial microdiversity with high accuracy, full length 16S
by myesha-ticknor
* Corresponding author: Aaron Darling, email: aaro...
The Oral Microbiome
by conchita-marotz
and . Salivary Biomarkers . in Health and Disease...
Robert Edgar
by briana-ranney
Independent scientist. robert@drive5.com. www.dri...
Eye color
by giovanna-bartolotta
Hair color. Height. Nose size. Foot size. Brown. ...
The Human Microbiome The Biology of Microorganisms
by greyergy
Microorganisms found across all three domains of l...
Yan Wei Lim (San Diego State University)
by maniakiali
Ann . Lesnefsky. (Stanford University). Sarah Dou...
www.pelagiaresearchlibrary.com
by morgan
t Available online a Pelagia Research LibraryEu...
Characterization of Novel BacillusSpecies and Reclassification Bacillu
by isabella2
Background:Unknown Microbe Lab identifies isolates...
BioinformaticsCodeLornaEDrakeCodes18wererunusingbashcodeonCardi27Univ
by payton
grep16CTACTAAGACGAGAAAGACCCT17R01fastqx0000R01Fora...
Function of the Message
by helene
SMPG-MP-SR-Page 1of 19Settlement and Reconciliatio...
Chronic pain (primary and secondary) in over 16s: assessment of all chronic pain and management of
by madeline
NICE guideline [NG193]Published: 07 April 2021. Dr...
Introduction to Microbiome & Discussion of He, et al.
by WeirdoWonder
Paer. Amir Zarrinpar, MD, PhD. Assistant Professor...
For over a hundred years chronic prostatitis was considered an infect
by vivian
www.icurology.orgNickelhttps://doi.org/10.4111/icu...
Figure 1 Figure 1. Neighbor-joining tree of a 1,341-bp region of unique 16S rRNA gene sequ
by lydia
Simmon KE, Brown-Elliott BA, Ridge PG, Durtschi JD...
Figure 1 Figure 1. Phylogenetic trees for partial 16S rRNA gene sequences of an Anaplasma phagocyto
by emmy
Kim K, Yi J, Oh W, Kim N, Choi S, Choe P, et al. H...
Integrating Data in a Microbiome
by harper
Context. . Michael Shaffer. Catherine . Lozupone....
Figure 1 Figure 1. Dendogram derived from the 16S rRNA gene sequence analysis, showing the
by hanah
Chiu C, Waddingdon M, Hsieh W, Greenberg DE, Schre...
Determination of host-associated bacterial communities
by ida
In the . rhizospheres. of maize, acorn squash, an...
THE GOODS AND CHATTELS OF THOMAS PAGE, NEIF
by edolie
Holder of 48 acres at . Harton. in 1378. 3 oxen w...
Rhodococcus fascians -
by malakai805
A Rare Cause of Meningitis in a Human Host. Kiran ...
Load More...