Explore
Upload

DocSlides is a free service to upload presentations and documents.

Upload Now

Search Results for '16s'

16s published presentations and documents on DocSlides.

Midi-Heki--IO-16s.book Seite 2 Freitag, 10. Februar 2017 5:29 17 ..

Midi-Heki--IO-16s.book Seite 2 Freitag, 10. Februar 2017 5:29 17 ..

  • roxanne
  • 258 Slides

EN Midi Heki roof lightPlease read this instructio...

Heki3-Plus--IO-16s.book Seite 1 Dienstag, 10. Januar 2017 6:03 18 .

Heki3-Plus--IO-16s.book Seite 1 Dienstag, 10. Januar 2017 6:03 18 .

  • lucinda
  • 186 Slides

1 W 1

16S phylogeny of the

16S phylogeny of the

  • reagan
  • 28 Slides

. Streptomycetaceae. Alan Ward. Motivation. Strept...

Figure Figure. Chest computed tomography scan and sequencing of the 16S amplicon in a 77-year-old m

Figure Figure. Chest computed tomography scan and sequencing of the 16S amplicon in a 77-year-old m

  • eve
  • 1 Slides

Moon J, Jang Y, Kim N, Park W, Park K, Lee S, et a...

analysis of Illumina MiSeq 16S rRNA gene amplicon data signifies the p

analysis of Illumina MiSeq 16S rRNA gene amplicon data signifies the p

  • briana-ranney
  • 100 Slides

16S rRNA gene sequencing. Sequencing of material f...

Genetic diversity of

Genetic diversity of

  • tatiana-dople
  • 5 Slides

Rhizobium. sp. in Russian Federation and Ukraine...

A Comprehensive Workflow for Microbial Genome Sequencing

A Comprehensive Workflow for Microbial Genome Sequencing

  • mitsue-stanley
  • 5 Slides

From Swab to Publication. Madison I. Dunitz. 1. ,...

John C.F. Hsieh, MPH Bioinformatics and Computational Biology

John C.F. Hsieh, MPH Bioinformatics and Computational Biology

  • alexa-scheidler
  • 0 Slides

PhD Candidate. June 11, 2018. Metagenomics Monday...

MidiHekiStyle B

MidiHekiStyle B

  • iris
  • 184 Slides

1 AB 700 mm CB 12 mm

MidiHekiStyle B

MidiHekiStyle B

  • dandy
  • 184 Slides

1AB700 mmCB12 mm 24 mm2WMidi-Heki-700x500--IO-16sb...

Figure 1 Figure 1. Neighbor-joining phylogenetic tree based on 16S rRNA gene sequence anal

Figure 1 Figure 1. Neighbor-joining phylogenetic tree based on 16S rRNA gene sequence anal

  • faith
  • 1 Slides

Hall AJ, Cassiday PK, Bernard KA, Bolt F, Steigerw...

Figure 3 Figure 3. Phylogenetic tree showing the 16S rRNA relationships of our Clostridium

Figure 3 Figure 3. Phylogenetic tree showing the 16S rRNA relationships of our Clostridium

  • rodriguez
  • 1 Slides

Elsayed S, Zhang K. Human Infection Caused by Clos...

Integrating Data in a

Integrating Data in a

  • liane-varnes
  • 6 Slides

Microbiome. Context. . Michael Shaffer. Catheri...

Practical Bioinformatics

Practical Bioinformatics

  • calandra-battersby
  • 57 Slides

Community structure . measures for meta-genomics...

rapped dendograms of the mitochondrial 16S gene were constructed using

rapped dendograms of the mitochondrial 16S gene were constructed using

  • faustina-dinatale
  • 100 Slides

Xeneretmus leiops AY785299 Xeneretmus latifrons ...

Yan Wei Lim (San Diego State University)

Yan Wei Lim (San Diego State University)

  • min-jolicoeur
  • 58 Slides

Ann . Lesnefsky. (Stanford University). Sarah Do...

Bacterial chromosome

Bacterial chromosome

  • calandra-battersby
  • 47 Slides

16S . rRNA. gene. ". ". Primers. 16S . rRNA. ge...

Resolving microbial microdiversity with high accuracy, full length 16S

Resolving microbial microdiversity with high accuracy, full length 16S

  • myesha-ticknor
  • 100 Slides

* Corresponding author: Aaron Darling, email: aaro...

The Oral Microbiome

The Oral Microbiome

  • conchita-marotz
  • 33 Slides

and . Salivary Biomarkers . in Health and Disease...

Robert Edgar

Robert Edgar

  • briana-ranney
  • 35 Slides

Independent scientist. robert@drive5.com. www.dri...

Eye color

Eye color

  • giovanna-bartolotta
  • 13 Slides

Hair color. Height. Nose size. Foot size. Brown. ...

The Human Microbiome The Biology of Microorganisms

The Human Microbiome The Biology of Microorganisms

  • greyergy
  • 27 Slides

Microorganisms found across all three domains of l...

Yan Wei Lim (San Diego State University)

Yan Wei Lim (San Diego State University)

  • maniakiali
  • 53 Slides

Ann . Lesnefsky. (Stanford University). Sarah Dou...

Mini Heki Style1256734

Mini Heki Style1256734

  • emily
  • 134 Slides

1 400 mm400 mm 1.2. W 1

www.pelagiaresearchlibrary.com

www.pelagiaresearchlibrary.com

  • morgan
  • 7 Slides

t Available online a Pelagia Research LibraryEu...

Characterization of Novel BacillusSpecies and Reclassification Bacillu

Characterization of Novel BacillusSpecies and Reclassification Bacillu

  • isabella2
  • 1 Slides

Background:Unknown Microbe Lab identifies isolates...

BioinformaticsCodeLornaEDrakeCodes18wererunusingbashcodeonCardi27Univ

BioinformaticsCodeLornaEDrakeCodes18wererunusingbashcodeonCardi27Univ

  • payton
  • 6 Slides

grep16CTACTAAGACGAGAAAGACCCT17R01fastqx0000R01Fora...

Function of the Message

Function of the Message

  • helene
  • 19 Slides

SMPG-MP-SR-Page 1of 19Settlement and Reconciliatio...

Chronic pain (primary and secondary) in over 16s: assessment of all chronic pain and management of

Chronic pain (primary and secondary) in over 16s: assessment of all chronic pain and management of

  • madeline
  • 26 Slides

NICE guideline [NG193]Published: 07 April 2021. Dr...

Introduction to Microbiome & Discussion of He, et al.

Introduction to Microbiome & Discussion of He, et al.

  • WeirdoWonder
  • 33 Slides

Paer. Amir Zarrinpar, MD, PhD. Assistant Professor...

For over a hundred years chronic prostatitis was considered an infect

For over a hundred years chronic prostatitis was considered an infect

  • vivian
  • 3 Slides

www.icurology.orgNickelhttps://doi.org/10.4111/icu...

Figure 1 Figure 1. Neighbor-joining tree of a 1,341-bp region of unique 16S rRNA gene sequ

Figure 1 Figure 1. Neighbor-joining tree of a 1,341-bp region of unique 16S rRNA gene sequ

  • lydia
  • 1 Slides

Simmon KE, Brown-Elliott BA, Ridge PG, Durtschi JD...

Figure 1 Figure 1. Phylogenetic trees for partial 16S rRNA gene sequences of an Anaplasma phagocyto

Figure 1 Figure 1. Phylogenetic trees for partial 16S rRNA gene sequences of an Anaplasma phagocyto

  • emmy
  • 1 Slides

Kim K, Yi J, Oh W, Kim N, Choi S, Choe P, et al. H...

Metagenomic binning of a marine sponge microbiome reveals unity in defense but metabolic specializa

Metagenomic binning of a marine sponge microbiome reveals unity in defense but metabolic specializa

  • pagi
  • 12 Slides

Slaby BM. , Hackl T, Horn H, Bayer K, Hentschel U....

Integrating Data in a Microbiome

Integrating Data in a Microbiome

  • harper
  • 6 Slides

Context. . Michael Shaffer. Catherine . Lozupone....

Figure 1 Figure 1. Dendogram derived from the 16S rRNA gene sequence analysis, showing the

Figure 1 Figure 1. Dendogram derived from the 16S rRNA gene sequence analysis, showing the

  • hanah
  • 1 Slides

Chiu C, Waddingdon M, Hsieh W, Greenberg DE, Schre...

Determination of host-associated bacterial communities

Determination of host-associated bacterial communities

  • ida
  • 20 Slides

In the . rhizospheres. of maize, acorn squash, an...

THE GOODS AND CHATTELS OF THOMAS PAGE, NEIF

THE GOODS AND CHATTELS OF THOMAS PAGE, NEIF

  • edolie
  • 8 Slides

Holder of 48 acres at . Harton. in 1378. 3 oxen w...

Rhodococcus fascians -

Rhodococcus fascians -

  • malakai805
  • 11 Slides

A Rare Cause of Meningitis in a Human Host. Kiran ...

Copyright © 2024 DocSlides. All Rights Reserved