PDF-FlyBase are extremely sensitive to Gramnegative bacterialinfections
Author : valerie | Published Date : 2022-09-20
2606 frame ORF was cloned into the I site of pAc51cMYCHISAusing the following PCR primers AcCYLDF 5CCCGAATTCC A AAATGATCTTAAACAACAA AAG TAAAAC3CCCCTCGAGATGGTACATCATTA
Presentation Embed Code
Download Presentation
Download Presentation The PPT/PDF document "FlyBase are extremely sensitive to Gramn..." is the property of its rightful owner. Permission is granted to download and print the materials on this website for personal, non-commercial use only, and to display it on your personal computer provided you do not modify the materials and that you retain all copyright notices contained in the materials. By downloading content from our website, you accept the terms of this agreement.
FlyBase are extremely sensitive to Gramnegative bacterialinfections: Transcript
Download Document
Here is the link to download the presentation.
"FlyBase are extremely sensitive to Gramnegative bacterialinfections"The content belongs to its owner. You may download and print it for personal use, without modification, and keep all copyright notices. By downloading, you agree to these terms.
Related Documents
