PDF-FlyBase are extremely sensitive to Gramnegative bacterialinfections

2606 frame ORF was cloned into the I site of pAc51cMYCHISAusing the following PCR primers AcCYLDF 5CCCGAATTCC A AAATGATCTTAAACAACAA AAG TAAAAC3CCCCTCGAGATGGTACATCATTA

cyld drosophila expression flies drosophila cyld flies expression 2003 fat gram pcr pathway type gene negative shown 2001 imd

Presentation Embed Code

<iframe width="560" height="315" src="https://www.docslides.com/embed/954422" frameborder="0" allowfullscreen></iframe>

Download Presentation

Download Presentation The PPT/PDF document "FlyBase are extremely sensitive to Gramn..." is the property of its rightful owner. Permission is granted to download and print the materials on this web site for personal, non-commercial use only, and to display it on your personal computer provided you do not modify the materials and that you retain all copyright notices contained in the materials. By downloading content from our website, you accept the terms of this agreement.