PDF-FlyBase are extremely sensitive to Gramnegative bacterialinfections

PDF-FlyBase are extremely sensitive to Gramnegative bacterialinfections thumbnail
2606 frame ORF was cloned into the I site of pAc51cMYCHISAusing the following PCR primers AcCYLDF 5CCCGAATTCC A AAATGATCTTAAACAACAA AAG TAAAAC3CCCCTCGAGATGGTACATCATTA

Download Presentation

"FlyBase are extremely sensitive to Gramnegative bacterialinf " is the property of its rightful owner. Permission is granted to download and print materials on this website for personal, non-commercial use only, provided you retain all copyright notices. By downloading content from our website, you accept the terms of this agreement. Download

Presentation Transcript

Transcript not available.

Related Topics