Upload
Featured Recent Articles Topics Login Upload

Search Results for 'species data'

species data published presentations and documents on DocSlides.

Results Ecology , Behavior, and Reproduction of Invasive Egyptian Geese (
Results Ecology , Behavior, and Reproduction of Invasive Egyptian Geese (
by celsa-spraggs
Alopochen. . aegyptiaca. ) in . Texas. Corey T. ...
A New Look at the Major Features of Evolution
A New Look at the Major Features of Evolution
by luanne-stotts
Stevan J. Arnold. Department of Integrative Biolo...
Combining remote-sensing and biological data to predict the consequences of climate change on hummi
Combining remote-sensing and biological data to predict the consequences of climate change on hummi
by pamella-moone
Catherine Graham, . Susan Wethington. , Donald Po...
Bell-ringer: 7 minutes
Bell-ringer: 7 minutes
by giovanna-bartolotta
Evaluate . the . successfulness and effectiveness...
Use of Control Samples in Seed Testing
Use of Control Samples in Seed Testing
by liane-varnes
Bryce . Callighan. Melissa Phillips. Monsanto - W...
MIR and FIR Analysis of Inorganic Species in a Single Data Acquisition
MIR and FIR Analysis of Inorganic Species in a Single Data Acquisition
by briana-ranney
Peng Wang, Sergey . Shilov, Bruker . Optics, Bruk...
Climate change damage functions in LCA
Climate change damage functions in LCA
by marina-yarberry
– . (2) data availability and selection of indi...
COSA Committee
COSA Committee
by tawny-fly
Meeting . June 23. 2017. DONNA SCHROEDER. Marin...
Presentation compiled with
Presentation compiled with
by trish-goza
unvalidated. data.. Began in 1991 as a non-profi...
Using citizen science, academic research and a summer fello
Using citizen science, academic research and a summer fello
by tatiana-dople
Science with Songbirds. Why songbirds? . A Lesso...
Pacific Inland Resources
Pacific Inland Resources
by phoebe-click
Landscape Reforestation Standard. . . In . Sear...
Oregon Department of Forestry
Oregon Department of Forestry
by yoshiko-marsland
Forest Inventory Systems and Lidar. Operationaliz...
Bernard
Bernard
by yoshiko-marsland
Bustier. a. †. . , . Alfred . Ngoye. b. , . St...
ATGTTCTATCCCATTCATTTTGACGTTATTGTTGTTGGAGGAGGTCATGCTGGGACAGA
ATGTTCTATCCCATTCATTTTGACGTTATTGTTGTTGGAGGAGGTCATGCTGGGACAGA
by pasty-toler
DNA sequencing. Why? . – Identifies . Organisms...
Use of dynamic factor analysis to estimate trends in abunda
Use of dynamic factor analysis to estimate trends in abunda
by olivia-moreira
Michael Scott Sherburne. Cassidy . D Peterson. Ro...
Improving gene trees without more data
Improving gene trees without more data
by giovanna-bartolotta
Master Thesis . By. Ashu Gupta. 1. Phylogenetic P...
Numbers of Students Who Had
Numbers of Students Who Had
by stefany-barnette
More. Than, Less than,. . or One . Prey . Anima...
Aquatic Invasive Species Distribution
Aquatic Invasive Species Distribution
by conchita-marotz
Geography 1820. Background Information. Aquatic i...
Meta-analysis of reef fish data in Hawaii to examine natura
Meta-analysis of reef fish data in Hawaii to examine natura
by briana-ranney
Alan Friedlander. 1. , Mary Donovan. 1. ,. Kosta....
SCE 4310 U01 CLASS #9
SCE 4310 U01 CLASS #9
by tatyana-admore
OCTOBER 18, 2016. AGENDA, NOTES, PHOTOS, RESOURCE...
Development of a cost efficient model for nature conservati
Development of a cost efficient model for nature conservati
by celsa-spraggs
David Lehrer. Advisors. Prof Pua Bar Kutiel and P...
Biodiversity is the variety of plants, animals, and other o
Biodiversity is the variety of plants, animals, and other o
by alexa-scheidler
Abstract. Question. Salinity kit. Soil testing ki...
Emily Finch
Emily Finch
by kittie-lecroy
Department of Biology. Calvin College. Turn down ...
Rocky Mountain Chapter
Rocky Mountain Chapter
by tawny-fly
Golf Course Superintendents. Association of Ameri...
Ecology of Open Algae Ponds
Ecology of Open Algae Ponds
by liane-varnes
Rob McBride. October. . 2014. Sapphire Produces ...
Will The TMDL Result in Increased Benefits from Recreationa
Will The TMDL Result in Increased Benefits from Recreationa
by lois-ondreau
Doug Lipton. Department of Agricultural & Res...
Novel methods improve prediction of species distributions from occurrence data Jane Elith Catherine H
Novel methods improve prediction of species distributions from occurrence data Jane Elith Catherine H
by ellena-manuel
Graham Robert P Anderson Miroslav Dud k Simon Fer...
REVIEW AND SYNTHESIS Mechanistic niche modelling combining physiological and spatial data to predict species ranges Michael Kearney and Warren Porter Department of Zoology The University of Melbourn
REVIEW AND SYNTHESIS Mechanistic niche modelling combining physiological and spatial data to predict species ranges Michael Kearney and Warren Porter Department of Zoology The University of Melbourn
by myesha-ticknor
3010 Australia Department of Zoology The Universi...
Supplementary data Characterization and phylogenetic analysis of gliadin gene sequences reveals signicant genomic divergence in Triticeae species GuangRong Li Tao Lang EnNian Yang Cheng Liu and ZuJun
Supplementary data Characterization and phylogenetic analysis of gliadin gene sequences reveals signicant genomic divergence in Triticeae species GuangRong Li Tao Lang EnNian Yang Cheng Liu and ZuJun
by kittie-lecroy
Genet 93 725731 Table 1 The gliadin gene sequen...
MICHIGAN FROG AND TOAD SURVEY Michigan Department of N
MICHIGAN FROG AND TOAD SURVEY Michigan Department of N
by ellena-manuel
1 . All sites must be easily accessible a...
Developing genome
Developing genome
by liane-varnes
sequencing . for . identification,. detection, . ...
Sediment Quality Assessment and New York City Watersheds
Sediment Quality Assessment and New York City Watersheds
by sherrill-nordquist
NYC Watershed/. Tifft. Science & Technical Sy...
North American Bat Monitoring Program (
North American Bat Monitoring Program (
by trish-goza
NABat. ). . Core Team & Supporters. Susan Lo...
Climate change damage functions in LCA
Climate change damage functions in LCA
by phoebe-click
– . (2) data availability and selection of indi...
Methods
Methods
by trish-goza
Acidification Tolerance of Aquatic Organisms . An...
Tough Times in Death Valley Soils:
Tough Times in Death Valley Soils:
by tatyana-admore
Geochemical . Stressors . and Diversification . o...
Decision Trees in R
Decision Trees in R
by luanne-stotts
Arko. . Barman. Slightly edited by Ch. . Eick. C...
Frontiers
Frontiers
by tawny-fly
in Fuels Science: . Species-Specific Crown Profil...
Developing UK indicators for the Strategic Plan for Biodive
Developing UK indicators for the Strategic Plan for Biodive
by giovanna-bartolotta
Data issues. Any measure of habitat connectivity ...
Global Processes, Including C, N
Global Processes, Including C, N
by alexa-scheidler
Cycles. and the Upper Troposphere and Lower Stra...