Explore
Upload

DocSlides is a free service to upload presentations and documents.

Upload Now

Search Results for 'Sequencing Genome'

Sequencing Genome published presentations and documents on DocSlides.

Transcriptome

Transcriptome

  • sherrill-nordquist
  • 70 Slides

reconstruction and quantification. Lecture: algo...

Getting Started with IGV

Getting Started with IGV

  • pasty-toler
  • 81 Slides

Programming for Biology 2015. Madelaine Gogol. Pr...

NEXT – GEN SEQUENCING TECHNIQUES

NEXT – GEN SEQUENCING TECHNIQUES

  • kittie-lecroy
  • 29 Slides

INTRODUCTION . The most commonly used technology...

Phylogeny &

Phylogeny &

  • myesha-ticknor
  • 68 Slides

Systematics. Phylogeny. Phylon. = tribe, ...

Conclusions and Future Work

Conclusions and Future Work

  • tatiana-dople
  • 11 Slides

. AGeS: A Software System for Annotation and Ana...

Web Databases for

Web Databases for

  • pamella-moone
  • 43 Slides

Drosophila. An introduction to web tools, databas...

Analysis of Next Generation Sequence Data

Analysis of Next Generation Sequence Data

  • luanne-stotts
  • 53 Slides

BIOST 2055. 04/06/2015. Last Lecture . Genome-wid...

BE/APh161 – Physical Biology of the Cell

BE/APh161 – Physical Biology of the Cell

  • tatiana-dople
  • 18 Slides

Rob Phillips. Applied Physics and Bioengineering....

Purposes and features

Purposes and features

  • lois-ondreau
  • 37 Slides

Browse genes in their genomic context.. See featu...

CARP Viewer

CARP Viewer

  • faustina-dinatale
  • 22 Slides

Red Team. 3/3/15. Red Team: CARP Viewer. 1. Genom...

Student Engagement: Programs At-A-Glance—Designing Course

Student Engagement: Programs At-A-Glance—Designing Course

  • karlyn-bohler
  • 25 Slides

As . we ask our students to participate in creati...

Paul Vincelli

Paul Vincelli

  • stefany-barnette
  • 72 Slides

Extension Professor and. Provost’s Distinguishe...

MBV2010

MBV2010

  • calandra-battersby
  • 33 Slides

Colloquium, January 28. RULES. Multiple choice. O...

Modules 11, 12, 13

Modules 11, 12, 13

  • alida-meadow
  • 62 Slides

Nature, Nurture, and Human Diversity. Behavior Ge...

Governance, Regulation, and Control:

Governance, Regulation, and Control:

  • celsa-spraggs
  • 17 Slides

Of Which People, By Which People, For Which Peopl...

RNA-directed Viral Assembly

RNA-directed Viral Assembly

  • natalia-silvester
  • 43 Slides

I. ) Self-Assembly and Free Energy Minimization.....

ENCODE 2012

ENCODE 2012

  • conchita-marotz
  • 19 Slides

The Human Genome project sequenced “the human g...

Genome-wide analysis of enhancer-RNA transcription reveals

Genome-wide analysis of enhancer-RNA transcription reveals

  • tawny-fly
  • 32 Slides

(TZD) . in . adipocytes. Kyoung-Jae Won, . Ph.D.....

U nknown genetic predisposition

U nknown genetic predisposition

  • tatyana-admore
  • 31 Slides

in familial breast cancer . . can . lie deep in ...

IMGS 2012

IMGS 2012

  • briana-ranney
  • 45 Slides

Bioinformatics . Workshop:. RNA . Seq. using Gal...

James Lindsay*

James Lindsay*

  • pamella-moone
  • 32 Slides

, . Hamed. . Salooti. , Alex . Zelikovski. , Ion...

Decoding

Decoding

  • tatyana-admore
  • 22 Slides

epigenome with integrative “omics” data analy...

P. Tang (

P. Tang (

  • myesha-ticknor
  • 35 Slides

鄧致剛. ). ; PJ Huang (. 黄栢榕. ). Bioinfo...

Genome Editing In the Clinic

Genome Editing In the Clinic

  • liane-varnes
  • 33 Slides

Fyodor D. Urnov, PhD. Project Leader and Senior S...

Genome Analysis of

Genome Analysis of

  • olivia-moreira
  • 23 Slides

L. . donovani. . : revealing the correlation of ...

Accepted for publication in

Accepted for publication in

  • min-jolicoeur
  • 100 Slides

1 Astrophysics and Space Science DNA SEQUENCING AN...

A high-resolution map of human evolutionary constraints usi

A high-resolution map of human evolutionary constraints usi

  • trish-goza
  • 27 Slides

Kerstin . Lindblad-. Toh. . et al. . 2011. Prese...

Genome-Wide Association Study (GWAS)

Genome-Wide Association Study (GWAS)

  • liane-varnes
  • 27 Slides

Presented by Karen . Xu. What you need to know. B...

Detecting selection using genome scans

Detecting selection using genome scans

  • ellena-manuel
  • 36 Slides

Roger Butlin. University of Sheffield. Nielsen R....

Brettanomyces

Brettanomyces

  • tatyana-admore
  • 31 Slides

Aroma and Flavor Effects. Lucy Joseph. Departmen...

Viral Evolution in

Viral Evolution in

  • ellena-manuel
  • 21 Slides

Endosymbionts. February 11, . 2012. Seth Bordenst...

Genomics of the haptophyte

Genomics of the haptophyte

  • ellena-manuel
  • 13 Slides

Chrysochromulina tobin. : Cell Division, Lipid Pr...

GE3M25:

GE3M25:

  • giovanna-bartolotta
  • 71 Slides

Data Analysis. Karsten Hokamp, PhD. Genetics. TCD...

Digital information preservation

Digital information preservation

  • phoebe-click
  • 42 Slides

in. DNA. Robust Chemical Preservation of Digital...

Outbreak of

Outbreak of

  • alexa-scheidler
  • 28 Slides

E. coli . O104:H4 heralds a new paradigm in respo...

TGCAAACTCAAACTCTTTTGTTGTTCTTACTGTATCATTGCCCAGAATAT

TGCAAACTCAAACTCTTTTGTTGTTCTTACTGTATCATTGCCCAGAATAT

  • olivia-moreira
  • 43 Slides

TCTGCCTGTCTTTAGAGGCTAATACATTGATTAGTGAATTCCAATGGGC...

Web-based analysis of (epi-) genome data using EpiGRAPH and Christoph

Web-based analysis of (epi-) genome data using EpiGRAPH and Christoph

  • pamella-moone
  • 100 Slides

http://galaxyproject.org/ for genome and epigenome...

The Autism Genome Project and Genocide

The Autism Genome Project and Genocide

  • danika-pritchard
  • 23 Slides

The Unbearable Uncertainty of Being (Autistic). P...

Techniques of Molecular Biology

Techniques of Molecular Biology

  • faustina-dinatale
  • 64 Slides

Basic molecular biology techniques. Isolating nuc...

Costs and benefits of sexual reproduction:

Costs and benefits of sexual reproduction:

  • celsa-spraggs
  • 22 Slides

The . disadvantages and advantages of sexual . re...

Copyright © 2024 DocSlides. All Rights Reserved