Upload
Featured Recent Articles Topics Login Upload

Search Results for 'sequence alignment'

sequence alignment published presentations and documents on DocSlides.

CS/BIOE 598: Algorithmic Computational Genomics
CS/BIOE 598: Algorithmic Computational Genomics
by provingintel
Tandy Warnow. Departments of Bioengineering and Co...
http://cs273a.stanford.edu [BejeranoFall15/16]
http://cs273a.stanford.edu [BejeranoFall15/16]
by impristic
1. MW  . 1:30-2:50pm . in . Clark . S361*. (behi...
Evolution of toxin-antitoxin systems in
Evolution of toxin-antitoxin systems in
by enjoinsamsung
Streptococcus . bacteria. Sarah Cook. Carnegie Mel...
Repeats and composition bias
Repeats and composition bias
by contessi
Miguel . Andrade. Faculty of Biology, . Johannes G...
Genome curation guide Empowering the Medfly community by Alexie Papanicolaou, Monica
Genome curation guide Empowering the Medfly community by Alexie Papanicolaou, Monica
by lois-ondreau
Genome curation guide Empowering the Medfly com...
http://cs273a.stanford.edu [Bejerano Winter 2017/18]
http://cs273a.stanford.edu [Bejerano Winter 2017/18]
by liane-varnes
1. MW  . 1:30-2:50pm. Prof: Gill . Bejerano. CAs...
Lecture invitation 8.4. 2015 AI, 14:30 (we will finish earlier this day, at 14:20)
Lecture invitation 8.4. 2015 AI, 14:30 (we will finish earlier this day, at 14:20)
by pamella-moone
How Lab IT Accelerates . Pharmaceutical . Researc...
Repeats and composition bias
Repeats and composition bias
by faustina-dinatale
Repeats. Frequency. 14% proteins contains . repea...
Prediction of protein features.
Prediction of protein features.
by giovanna-bartolotta
Beyond protein structure. Miguel . Andrade. Facul...
Comparative genomics
Comparative genomics
by olivia-moreira
Joachim Bargsten. February 2012. Comparative . ge...
Repeats and composition bias
Repeats and composition bias
by lois-ondreau
Miguel . Andrade. Faculty of Biology, . Johannes ...
Profile HMMs
Profile HMMs
by pamella-moone
Tandy Warnow. BioE. /CS 598AGB. Profile Hidden Ma...
http://cs273a.stanford.edu [Bejerano Fall16/17]
http://cs273a.stanford.edu [Bejerano Fall16/17]
by lindy-dunigan
1. CS273A. Lecture . 14: . Inferring Evolution: C...
http://cs273a.stanford.edu [BejeranoFall14/15]
http://cs273a.stanford.edu [BejeranoFall14/15]
by sherrill-nordquist
1. MW  . 12:50-2:05pm . in Beckman . B100. Profs...
Introduction To Next Generation Sequencing (NGS) Data Anal
Introduction To Next Generation Sequencing (NGS) Data Anal
by karlyn-bohler
Jenny . Wu. Outline. Goals : Practical guide to N...
DTC Gerton Lunter, WTCHG
DTC Gerton Lunter, WTCHG
by test
February 10, 2010. Hidden Markov models in Comput...
TGCAAACTCAAACTCTTTTGTTGTTCTTACTGTATCATTGCCCAGAATAT
TGCAAACTCAAACTCTTTTGTTGTTCTTACTGTATCATTGCCCAGAATAT
by olivia-moreira
TCTGCCTGTCTTTAGAGGCTAATACATTGATTAGTGAATTCCAATGGGC...
Usage of profile HMMs in Bioinformatics
Usage of profile HMMs in Bioinformatics
by luanne-stotts
Using PFAM database’s profile HMMs in MATLAB B...
The aim is to build a 3-D model for a protein of unknown st
The aim is to build a 3-D model for a protein of unknown st
by pasty-toler
target. ) on the basis of sequence similarity to ...
BLAST
BLAST
by natalia-silvester
Basic Local Alignment Search Tool. (Altschul et a...
Hidden Markov Models
Hidden Markov Models
by alida-meadow
(1). Brief . review of discrete time finite Marko...
DACIDR
DACIDR
by yoshiko-marsland
A Deterministic Annealing Clustering and Interpol...
Common Errors in
Common Errors in
by lindy-dunigan
Student Annotation Submissions. contributions fro...
CS 6293 AT: Current
CS 6293 AT: Current
by sherrill-nordquist
Bioinformatics. HW2. Papers. 1. . BLAT-. -The BLA...
Genomics and Personalized Care in Health Systems
Genomics and Personalized Care in Health Systems
by lois-ondreau
Lecture 5 Genome Browser. Leming Zhou, PhD. Schoo...
Reconstruction of infectious bronchitis virus
Reconstruction of infectious bronchitis virus
by tatyana-admore
quasispecies. from 454 . pyrosequencing. reads....
SCALABLE AND ROBUST
SCALABLE AND ROBUST
by briana-ranney
DATA CLUSTERING AND VISUALIZATION. Yang Ruan. PhD...
Last lecture summary
Last lecture summary
by sherrill-nordquist
New generation sequencing (NGS). The completion o...
CS/BIOE 598:
CS/BIOE 598:
by phoebe-click
Algorithmic Computational Genomics. Tandy Warnow....
1/2/3 dimensional visualization of RNA
1/2/3 dimensional visualization of RNA
by olivia-moreira
Yann. . Ponty. (VARNA), CNRS/. Ecole. . Polyte...
Mapping NGS sequences to a reference genome
Mapping NGS sequences to a reference genome
by debby-jeon
Why?. Resequencing. studies (DNA). Structural va...
Protein Sequencing and Identification by Mass Spectrometry
Protein Sequencing and Identification by Mass Spectrometry
by briana-ranney
Outline. Tandem Mass Spectrometry. De Novo Peptid...
Semantic and phonetic automatic reconstruction of
Semantic and phonetic automatic reconstruction of
by ellena-manuel
medical dictations. Stefan Petrik . , . Christina...
TGCAAACTCAAACTCTTTTGTTGTTCTTACTGTATCATTGCCCAGAATAT
TGCAAACTCAAACTCTTTTGTTGTTCTTACTGTATCATTGCCCAGAATAT
by luanne-stotts
TCTGCCTGTCTTTAGAGGCTAATACATTGATTAGTGAATTCCAATGGGC...
Read Processing and Mapping:
Read Processing and Mapping:
by olivia-moreira
From Raw to Analysis-ready Reads. Ben Passarelli ...
Next Generation Sequencing,
Next Generation Sequencing,
by myesha-ticknor
Assembly, and Alignment Methods . Andy Nagar. Ag...
TimeLapseReg
TimeLapseReg
by test
an ImageJ plugin for drift correction of video se...
TRANSCRIPTION FACTORS
TRANSCRIPTION FACTORS
by trish-goza
Natàlia. . Morante. , . Aina. Maria . Nicolau....
Common Errors in
Common Errors in
by calandra-battersby
Student Annotation Submissions. contributions fro...