Upload
Featured Recent Articles Topics Login Upload

Search Results for 'primers'

primers published presentations and documents on DocSlides.

Designing the oligonucleotide primers for
Designing the oligonucleotide primers for
by alis
PCR. GENE TECHNIQUES . . Dr. Nadal A...
G.tigrina
G.tigrina
by sherrill-nordquist
. Hox. gene . DthoxC. insertion into prokaryot...
4 th Lab
4 th Lab
by eliza
Primer Design & Blast . Lecture Kamaran Mustaf...
Figure 6 Figure 6. . Genotypic characterization of wild-type flagellates by PCR amplification with
Figure 6 Figure 6. . Genotypic characterization of wild-type flagellates by PCR amplification with
by nicole
Teixeira A, Monteiro P, Rebelo JM, Argañaraz ER, ...
Figure 2 Figure 2. Sequences of Plasmodium vivax isolates are distinguished by variation i
Figure 2 Figure 2. Sequences of Plasmodium vivax isolates are distinguished by variation i
by linda
Li J, Collins WE, Wirtz RA, Rathore D, Lal A, McCu...
Yeast Colony PCR PCR provides a forensics tool for identifying colonies
Yeast Colony PCR PCR provides a forensics tool for identifying colonies
by layla
Three strains look alike!. How can you identify th...
Figure 1 Figure 1. A) Specificity of primers for PARV4. Samples in lanes 1–5 were amplif
Figure 1 Figure 1. A) Specificity of primers for PARV4. Samples in lanes 1–5 were amplif
by berey
Fryer JF, Kapoor A, Minor PD, Delwart E, Baylis SA...
Unit 2: The Genome Chapter 6 - Polymerase Chain Reaction
Unit 2: The Genome Chapter 6 - Polymerase Chain Reaction
by samantha
Figure 6.01. Polymerase Chain Reaction (PCR). Duri...
Figure 1 Figure 1. Verification of toxin gene deletions and the genetic structure of the construct
Figure 1 Figure 1. Verification of toxin gene deletions and the genetic structure of the construct
by elina
Plaut RD, Staab AB, Munson MA, Gebhardt JS, Klimko...
Molecular diagnosis of human
Molecular diagnosis of human
by HotMess
papillomavirus. (HPV)oral infections. . Dr. Osam...
G.tigrina Hox gene DthoxC
G.tigrina Hox gene DthoxC
by gabriella
insertion into prokaryote . E.coli. . – by . UN...
Non-human Cell Line Authentication
Non-human Cell Line Authentication
by margaret
Methods to Authenticate . Non-human Cells. Identif...
Sompong Te-chato and Mii MasahiroTe-chato, S., Lim, M. and Masahir
Sompong Te-chato and Mii MasahiroTe-chato, S., Lim, M. and Masahir
by grewhypo
ORIGINAL ARTICLE ORIGINAL ARTICLE  " ...
PCR way of copying specific DNA fragments from small sample DNA material
PCR way of copying specific DNA fragments from small sample DNA material
by alida-meadow
"molecular photocopying" . It’s fast, inexpensi...
Bioinformatics Methods for Diagnosis and Treatment of Human Diseases
Bioinformatics Methods for Diagnosis and Treatment of Human Diseases
by nonhurmer
Jorge . Duitama. Dissertation Proposal for the Deg...
Yeast Colony PCR
Yeast Colony PCR
by sherrill-nordquist
PCR provides a forensics tool for identifying col...
Why NCBI Tools are important for
Why NCBI Tools are important for
by natalia-silvester
breeding. plants . studies. genetically. . modi...
Outbreak of
Outbreak of
by alexa-scheidler
E. coli . O104:H4 heralds a new paradigm in respo...
Dot plot
Dot plot
by tawny-fly
Daniel Svozil. Software choice. source: Bioinform...
Polymerase Chain Reaction (PCR)
Polymerase Chain Reaction (PCR)
by debby-jeon
Nahla . Bakhamis. Multiple copies of specific DNA...
Choosing the Correct Primer
Choosing the Correct Primer
by sherrill-nordquist
Primers Solve Problems. Stain and Odors. Porous S...
Analysis of Three Plant Primers:
Analysis of Three Plant Primers:
by lois-ondreau
rbcL. , plant ITS, and . matK. , . to Determine t...
Using DNA Barcodes to Identify Mislabeled Red Snappers Sold
Using DNA Barcodes to Identify Mislabeled Red Snappers Sold
by alexa-scheidler
New . York City Fish Markets . Ajenae. Jackson. ...
Choosing the Correct Primer
Choosing the Correct Primer
by jane-oiler
Primers Solve Problems. Stain and Odors. Porous S...
Analysis of Three Plant Primers:
Analysis of Three Plant Primers:
by lois-ondreau
rbcL. , plant ITS, and . matK. , . to Determine t...
(BOOS)-The Sun\'s Influence on Climate (Princeton Primers in Climate, 11)
(BOOS)-The Sun\'s Influence on Climate (Princeton Primers in Climate, 11)
by DianeLara
The Earth\'s climate system depends entirely on th...
Genetics and Molecular Research 16 3 gmr16039796
Genetics and Molecular Research 16 3 gmr16039796
by oneill
Improving the PCR protocol to amplify a repetitiv...
with 30 at 55C nbutanol washed obtain a ruckeri DNA were checked
with 30 at 55C nbutanol washed obtain a ruckeri DNA were checked
by lydia
other bacter- used. The cular weight. with phenol-...
(BOOK)-Living Language: An Introduction to Linguistic Anthropology (Primers in Anthropology)
(BOOK)-Living Language: An Introduction to Linguistic Anthropology (Primers in Anthropology)
by AudreyWolfe
A new, fully revised edition of this bestselling t...
Site Directed Mutagenesis of ZsYellow
Site Directed Mutagenesis of ZsYellow
by garcia
102 103 LAB OVERVIEWZsYellow is a yellow fluoresce...
PCR quantitativo What is Real-Time PCR?
PCR quantitativo What is Real-Time PCR?
by topslugger
Real-Time PCR is a specialized technique that allo...
Genetics Engineering Lecture-3
Genetics Engineering Lecture-3
by Mindbender
Concept and basic steps in recombinant DNA technol...
Pcr MARCH 10, 2015 Lab 7
Pcr MARCH 10, 2015 Lab 7
by SweetMelody
Biol. 1208(r). overview. Where are we today?. How...
Introduction Mosquitoes are the most important and prevalent vector of disease-causing organisms wo
Introduction Mosquitoes are the most important and prevalent vector of disease-causing organisms wo
by HappyHippie
pathogens . which pose serious risk to human healt...
ATGTTCTATCCCATTCATTTTGACGTTATTGTTGTTGGAGGAGGTCATGCTGGGACAGAAGCAGCTTTGGCTTCTGCTAGGATGCAATGTAATACGCTT
ATGTTCTATCCCATTCATTTTGACGTTATTGTTGTTGGAGGAGGTCATGCTGGGACAGAAGCAGCTTTGGCTTCTGCTAGGATGCAATGTAATACGCTT
by jainy
DNA sequencing. Why? . – Identifies . Organisms....
Julia Paxson DVM DACVIM Analysis of Gene Expression
Julia Paxson DVM DACVIM Analysis of Gene Expression
by everly
- Overview -. Why gene expression analysis?. Quant...
Mapping Functional Domains of ORP3 Required for Suppression of ER Aggregation in ALS8
Mapping Functional Domains of ORP3 Required for Suppression of ER Aggregation in ALS8
by dora
Sohail Syed. ALS and ER Aggregation . Affects 1 pe...
Title : Simultaneous identification of
Title : Simultaneous identification of
by mia
Mycoplasma. . Gallisepticum. and . Mycoplasma. ...
IncompleteDJHrearrangementsoftheIgHgenearefrequentinmultiplemyelomapat
IncompleteDJHrearrangementsoftheIgHgenearefrequentinmultiplemyelomapat
by christina
CorrespondenceProfessorJSanMiguelHematologyDepartm...
mRNA Expression during an In Vitro Response of Human B Lymphocytes Kin
mRNA Expression during an In Vitro Response of Human B Lymphocytes Kin
by valerie
the Division of Hematology Department of Medicine ...