Explore
Upload

DocSlides is a free service to upload presentations and documents.

Upload Now

Search Results for 'Outbreak Genome'

Outbreak Genome published presentations and documents on DocSlides.

01010110001001010000101010101001101110011000110010100010010

01010110001001010000101010101001101110011000110010100010010

  • phoebe-click
  • 32 Slides

Introduction: Human Population Genomics. ACGTTTGA...

DNA Interlude

DNA Interlude

  • phoebe-click
  • 12 Slides

Classwork. Introduce yourself to your neighbor. E...

Local

Local

  • jane-oiler
  • 25 Slides

Emergency Management Roles in . Communicable Dise...

CONTENTS1.Confusion of Popular Names3.Habit(c)Buds(d)Leaves(e)Wasteful

CONTENTS1.Confusion of Popular Names3.Habit(c)Buds(d)Leaves(e)Wasteful

  • alexa-scheidler
  • 100 Slides

(1) INTRODUCTIONSoon after the outbreak of hostili...

Since the beginning of the outbreak in October 2010,

Since the beginning of the outbreak in October 2010,

  • mitsue-stanley
  • 100 Slides

the Ministry of Public Health and Population (MS...

Legionellosis Outbreak Associated with a Hotel Fountain, Ch

Legionellosis Outbreak Associated with a Hotel Fountain, Ch

  • briana-ranney
  • 54 Slides

June 11, 2013. Shamika Smith, MPH. Epidemiologist...

Genome size and Complexity

Genome size and Complexity

  • sherrill-nordquist
  • 22 Slides

(as told by Michael Lynch). Genome size and compl...

Mapping NGS sequences to a reference genome

Mapping NGS sequences to a reference genome

  • debby-jeon
  • 18 Slides

Why?. Resequencing. studies (DNA). Structural va...

Plant Molecular Systematics

Plant Molecular Systematics

  • karlyn-bohler
  • 40 Slides

Spring . 2014. “Problems” with morphological....

Multi-state measles outbreak linked to an amusement park in

Multi-state measles outbreak linked to an amusement park in

  • alida-meadow
  • 9 Slides

By early February 2015 CCHHS:. Received request f...

Introduction to Short

Introduction to Short

  • lindy-dunigan
  • 37 Slides

Read Sequencing . Analysis. Jim Noonan. GENE 760....

Mistreating Health Inequities:

Mistreating Health Inequities:

  • celsa-spraggs
  • 45 Slides

The New . Biopolitics. of Race, Health & Jus...

Mitochondrial genome

Mitochondrial genome

  • sherrill-nordquist
  • 23 Slides

r. eplacement in unfertilized . o. ocytes. for . ...

The contribution of anthropology to international outbreak

The contribution of anthropology to international outbreak

  • faustina-dinatale
  • 25 Slides

Fred Martineau (LSHTM). Annie Wilkinson (IDS). Eb...

Evolution of Mitochondrial Genome Architecture in Nematodes

Evolution of Mitochondrial Genome Architecture in Nematodes

  • lois-ondreau
  • 20 Slides

Sita Ping. Department of Zoology. Mentor: Dr. Dee...

GENOMICS ENGLAND AND

GENOMICS ENGLAND AND

  • yoshiko-marsland
  • 100 Slides

Page 1 of 7 THE 100,000 GENOME S PROJECT Genomic...

NDRSi

NDRSi

  • alida-meadow
  • 18 Slides

OUTBREAK . REPORTS. . NDRSi. Outbreak Reports. -...

DNA Sequencing

DNA Sequencing

  • lois-ondreau
  • 49 Slides

Method to sequence longer regions. cut many times...

Bioinformatics for Whole-Genome Shotgun Sequencing of Micro

Bioinformatics for Whole-Genome Shotgun Sequencing of Micro

  • myesha-ticknor
  • 32 Slides

By Kevin Chen, . Lior. . Pachter. PLoS. Computa...

1 Genome sizes (sample)

1 Genome sizes (sample)

  • myesha-ticknor
  • 65 Slides

2. Some genomics history. 1995: first bacterial g...

Why bacteria run Linux

Why bacteria run Linux

  • yoshiko-marsland
  • 46 Slides

while eukaryotes . run Windows?. Sergei Maslov. B...

Mapping Irregular

Mapping Irregular

  • giovanna-bartolotta
  • 9 Slides

Computations . to GPUs. Graphics processors (GPUs...

Pathogens Important to Infection Prevention and Control

Pathogens Important to Infection Prevention and Control

  • pamella-moone
  • 60 Slides

Learning objectives. List special pathogens of in...

ChIP-seq

ChIP-seq

  • yoshiko-marsland
  • 42 Slides

. Data . Analysis. Release DNA. Immunoprecipitat...

Bioinformatics

Bioinformatics

  • lois-ondreau
  • 48 Slides

. Analysis. Team . McGill . University. and . ...

The integrated cross-species

The integrated cross-species

  • luanne-stotts
  • 16 Slides

phenome. as a tool for . exploring disease. Meli...

Phylogeny

Phylogeny

  • min-jolicoeur
  • 24 Slides

- based on whole genome data. Johanne Ahrenfeldt ...

Western New York Genetics in Research Partnership

Western New York Genetics in Research Partnership

  • test
  • 18 Slides

Expanding Exposure, Career Exploration and Intera...

MOLECULAR BIOLOGY – PCR, sequencing, Genomics

MOLECULAR BIOLOGY – PCR, sequencing, Genomics

  • olivia-moreira
  • 57 Slides

MOLECULAR BIOLOGY TECHNIQUES II.. Polymerase Cha...

More Efficient Bioethanol from Poplar Wood?

More Efficient Bioethanol from Poplar Wood?

  • luanne-stotts
  • 12 Slides

Tues. 22. nd. May 2012, . EnergyAway. Day, . Ch...

Towards your own genome

Towards your own genome

  • alexa-scheidler
  • 50 Slides

Designing. . your. . Sequencing. Run. https://...

Regulation of Gene Expression

Regulation of Gene Expression

  • conchita-marotz
  • 69 Slides

13 February, 2013. Ansuman. . Chattopadhyay. , ...

Signatures of Accelerated Somatic Evolution in Gene Promote

Signatures of Accelerated Somatic Evolution in Gene Promote

  • debby-jeon
  • 9 Slides

Update Talk. Kyle Smith. De Lab. TERT Promoter. F...

Integrated Bioinformatics

Integrated Bioinformatics

  • jane-oiler
  • 6 Slides

Data . and Analysis . Tools for . Herpesviridae. ...

TGCAAACTCAAACTCTTTTGTTGTTCTTACTGTATCATTGCCCAGAATAT

TGCAAACTCAAACTCTTTTGTTGTTCTTACTGTATCATTGCCCAGAATAT

  • luanne-stotts
  • 45 Slides

TCTGCCTGTCTTTAGAGGCTAATACATTGATTAGTGAATTCCAATGGGC...

MCB 5472

MCB 5472

  • debby-jeon
  • 42 Slides

Student . Projects,. unix. ,. . Perl . J. Peter ...

Software for Robust Transcript Discovery and Quantification

Software for Robust Transcript Discovery and Quantification

  • marina-yarberry
  • 27 Slides

Seq. Ion . Mandoiu. , Alex . Zelikovsky. , . Serg...

GNUMap

GNUMap

  • stefany-barnette
  • 24 Slides

:. . Unbiased Probabilistic Mapping of Next-Gene...

Genome Rearrangements:

Genome Rearrangements:

  • lindy-dunigan
  • 139 Slides

from Biological . Problem to . Combinatorial Algo...

Genome Rearrangements

Genome Rearrangements

  • sherrill-nordquist
  • 64 Slides

Basic Biology: DNA. Genetic information is stored...

Copyright © 2024 DocSlides. All Rights Reserved