Explore
Upload

DocSlides is a free service to upload presentations and documents.

Upload Now

Search Results for 'Genome Subsurface'

Genome Subsurface published presentations and documents on DocSlides.

Genome Analysis of

Genome Analysis of

  • olivia-moreira
  • 23 Slides

L. . donovani. . : revealing the correlation of ...

A high-resolution map of human evolutionary constraints usi

A high-resolution map of human evolutionary constraints usi

  • trish-goza
  • 27 Slides

Kerstin . Lindblad-. Toh. . et al. . 2011. Prese...

Genome-Wide Association Study (GWAS)

Genome-Wide Association Study (GWAS)

  • liane-varnes
  • 27 Slides

Presented by Karen . Xu. What you need to know. B...

Detecting selection using genome scans

Detecting selection using genome scans

  • ellena-manuel
  • 36 Slides

Roger Butlin. University of Sheffield. Nielsen R....

Chapter 3 Section 3

Chapter 3 Section 3

  • kittie-lecroy
  • 20 Slides

The Formation, Mining, and Use of Minerals. What ...

Brettanomyces

Brettanomyces

  • tatyana-admore
  • 31 Slides

Aroma and Flavor Effects. Lucy Joseph. Departmen...

Viral Evolution in

Viral Evolution in

  • ellena-manuel
  • 21 Slides

Endosymbionts. February 11, . 2012. Seth Bordenst...

GE3M25:

GE3M25:

  • giovanna-bartolotta
  • 71 Slides

Data Analysis. Karsten Hokamp, PhD. Genetics. TCD...

Outbreak of

Outbreak of

  • alexa-scheidler
  • 28 Slides

E. coli . O104:H4 heralds a new paradigm in respo...

TGCAAACTCAAACTCTTTTGTTGTTCTTACTGTATCATTGCCCAGAATAT

TGCAAACTCAAACTCTTTTGTTGTTCTTACTGTATCATTGCCCAGAATAT

  • olivia-moreira
  • 43 Slides

TCTGCCTGTCTTTAGAGGCTAATACATTGATTAGTGAATTCCAATGGGC...

Web-based analysis of (epi-) genome data using EpiGRAPH and Christoph

Web-based analysis of (epi-) genome data using EpiGRAPH and Christoph

  • pamella-moone
  • 100 Slides

http://galaxyproject.org/ for genome and epigenome...

The Autism Genome Project and Genocide

The Autism Genome Project and Genocide

  • danika-pritchard
  • 23 Slides

The Unbearable Uncertainty of Being (Autistic). P...

Techniques of Molecular Biology

Techniques of Molecular Biology

  • faustina-dinatale
  • 64 Slides

Basic molecular biology techniques. Isolating nuc...

Costs and benefits of sexual reproduction:

Costs and benefits of sexual reproduction:

  • celsa-spraggs
  • 22 Slides

The . disadvantages and advantages of sexual . re...

Rhea, the Giovanni Mission, and you.

Rhea, the Giovanni Mission, and you.

  • marina-yarberry
  • 12 Slides

A presentation by Jared Stachiw . PhD, . MPhil. ...

The impact of next-generation sequencing technology of gene

The impact of next-generation sequencing technology of gene

  • sherrill-nordquist
  • 37 Slides

Elaine R. . Mardis. – 11 . February. . 2008. W...

A brief guide to sequencing

A brief guide to sequencing

  • conchita-marotz
  • 30 Slides

Dr Gavin Band. Wellcome. Trust Advanced Courses;...

Environmental Genome Shotgun Sequencing of the Sargasso Sea

Environmental Genome Shotgun Sequencing of the Sargasso Sea

  • jane-oiler
  • 18 Slides

Venter et. al (2004). Presented by. Ken . Vittaya...

Dwarfism

Dwarfism

  • tatiana-dople
  • 7 Slides

in . Sorghum . bicolor. . converted. . by. . ...

GEP Curriculum for Beginning STEM Majors

GEP Curriculum for Beginning STEM Majors

  • alexa-scheidler
  • 16 Slides

GEP Alumni Consortium. NSF Improving Undergraduat...

RNA-Seq Primer

RNA-Seq Primer

  • giovanna-bartolotta
  • 22 Slides

Understanding the RNA-Seq evidence tracks on . th...

Plant Molecular Systematics

Plant Molecular Systematics

  • test
  • 37 Slides

Spring . 2012. “Problems” with morphological....

A genome-wide perspective on translation of proteins

A genome-wide perspective on translation of proteins

  • conchita-marotz
  • 35 Slides

Dec 2012. Regulatory Genomics. Lecturer: Prof. Yi...

Dr G P S Raghava, Head Bioinformatics Centre

Dr G P S Raghava, Head Bioinformatics Centre

  • conchita-marotz
  • 41 Slides

Institute of Microbial Technology, Chandigarh, In...

Hidden magicians of genome evolution

Hidden magicians of genome evolution

  • alexa-scheidler
  • 100 Slides

C. Sandeep Kumar, Sameera Fatima Qureshi, Altaf Al...

GCATCCATCTTGGGGCGTCCCAATTGCTGAGTAACAAATGAGACGC CGTACTGCAACCGGCGGGCCACG

GCATCCATCTTGGGGCGTCCCAATTGCTGAGTAACAAATGAGACGC CGTACTGCAACCGGCGGGCCACG

  • test
  • 100 Slides

Lecture 4 Much of the genome remains to be annotat...

Assembly and Annotation of a 22Gb

Assembly and Annotation of a 22Gb

  • tatiana-dople
  • 68 Slides

C. onifer . G. enome, Loblolly Pine. Jill Wegrzyn...

Subsurface Topography

Subsurface Topography

  • min-jolicoeur
  • 16 Slides

Ocean Floor Features. Continental Shelf . The gen...

Riann

Riann

  • briana-ranney
  • 25 Slides

. Egusquiza. D145 Presentation. January 12, 2017...

Bioinformatics and Genetics

Bioinformatics and Genetics

  • yoshiko-marsland
  • 32 Slides

Kun Huang. Department of Biomedical Informatics. ...

Molecular Biology of Cancer AND

Molecular Biology of Cancer AND

  • mitsue-stanley
  • 52 Slides

Cancer Informatics (omics). David Boone. Outline....

Dr. George Church

Dr. George Church

  • tatiana-dople
  • 23 Slides

Professor,. . Department of Genetics. Harvard Me...

A Zero-Knowledge Based Introduction to Biology

A Zero-Knowledge Based Introduction to Biology

  • min-jolicoeur
  • 68 Slides

Karthik . Jagadeesh. , Bo . Yoo. 28. . September...

False negatives are common

False negatives are common

  • yoshiko-marsland
  • 23 Slides

with . initial and follow-up . biopsies.. Patient...

Dhanvantari

Dhanvantari

  • stefany-barnette
  • 17 Slides

. . GenOME. to hit. ...

Working Group Meeting

Working Group Meeting

  • tawny-fly
  • 48 Slides

February 29, 2016. 1. 888-844-9904. passcode . 2...

Mechanisms of Genetic Variation

Mechanisms of Genetic Variation

  • cheryl-pisano
  • 38 Slides

1. 16. Copyright © McGraw-Hill Global Education ...

Learning the Rules of Genome Design

Learning the Rules of Genome Design

  • alexa-scheidler
  • 18 Slides

. John Glass. for members of the . Venter Instit...

Genome Read In-Memory (GRIM) Filter:

Genome Read In-Memory (GRIM) Filter:

  • faustina-dinatale
  • 1 Slides

Fast Location Filtering in DNA Read Mapping using...

Molecular Biology Primer

Molecular Biology Primer

  • aaron
  • 21 Slides

Starting 19. th. century…. Cellular biology:. ...

Copyright © 2024 DocSlides. All Rights Reserved