Upload
Featured Recent Articles Topics Login Upload

Search Results for ''

published presentations and documents on DocSlides.

PHI-Canto: The PHI-base Canto tool for author self-curati
PHI-Canto: The PHI-base Canto tool for author self-curati
by test
1. http://curation.phi-base.org/. 2. Data capture...
Watch the animation and complete the card sort.
Watch the animation and complete the card sort.
by tawny-fly
The cell has reached the interphase of its cell c...
Pecha
Pecha
by ellena-manuel
. Kucha. :. Integrating . immune repertoire data...
R2D2: Embracing Device-to-Device Communication in Next Gene
R2D2: Embracing Device-to-Device Communication in Next Gene
by trish-goza
1. Tarun. . Bansal*, . Karthik. . Sundaresan. +...
Mutations (Ch. 17) Mutations
Mutations (Ch. 17) Mutations
by tabitha
Point mutations. single base change . silent mutat...
2/23/15 Learning Objectives
2/23/15 Learning Objectives
by rosemary
Content Objective: Investigate the process of gene...
Mutations Chapter 13.3 Types of Mutations
Mutations Chapter 13.3 Types of Mutations
by scarlett
The sequence of bases in DNA are like the letters ...
GENETIC CODE FILE 8: POINT MUTATIONS
GENETIC CODE FILE 8: POINT MUTATIONS
by eleanor
1. . In a mRNA sequence (. wt. ) there is a triple...
DNA Biomolecules – Remember
DNA Biomolecules – Remember
by elise
Carbohydrates. Lipids. Nucleic acids . – hold ge...
Lecture 5: Mutation and DNA Repair
Lecture 5: Mutation and DNA Repair
by teresa
(Chapter 12). Presented by Dr. Laurie M. Erickson....
ATGTTCTATCCCATTCATTTTGACGTTATTGTTGTTGGAGGAGGTCATGCTGGGACAGAAGCAGCTTTGGCTTCTGCTAGGATGCAATGTAATACGCTT
ATGTTCTATCCCATTCATTTTGACGTTATTGTTGTTGGAGGAGGTCATGCTGGGACAGAAGCAGCTTTGGCTTCTGCTAGGATGCAATGTAATACGCTT
by jainy
DNA sequencing. Why? . – Identifies . Organisms....
Mechanism of Deletion & Insertion, Transposable Elements & Chromosome Mutations.
Mechanism of Deletion & Insertion, Transposable Elements & Chromosome Mutations.
by elyana
P3, Classes –VIII. M.Sc. -IV Semester . . Dr. H...
Genetic variations Bahareh
Genetic variations Bahareh
by reese
Rabbani, PhD. Medical Genetics. Variation. Single ...
Bacterial genetics I Dr. Ali Abdulwahid
Bacterial genetics I Dr. Ali Abdulwahid
by payton
I. Remind ourselves with the Structure And the Fu...
Lecture 3 What is Mutation?
Lecture 3 What is Mutation?
by daniella
Is a natural process that changes a DNA sequence.....
LO: Describe the structure of DNA using diagrams.
LO: Describe the structure of DNA using diagrams.
by lam
Explain how the bases on the two strands link toge...
Unit 3c Microbial Genetics
Unit 3c Microbial Genetics
by susan
Microbial Genetics. Genetics. : the science of h...