Upload
Featured Recent Articles Topics Login Upload

Search Results for 'data species'

data species published presentations and documents on DocSlides.

PHYLOGENETIC DIVERSITY
PHYLOGENETIC DIVERSITY
by calandra-battersby
Methods and applications. Divya. B.. PK. lab, ....
Mauritius 3D
Mauritius 3D
by sherrill-nordquist
Science alive. Graduation Project. Bodo Schütze,...
ATGTTCTATCCCATTCATTTTGACGTTATTGTTGTTGGAGGAGGTCATGCTGGGACAGA
ATGTTCTATCCCATTCATTTTGACGTTATTGTTGTTGGAGGAGGTCATGCTGGGACAGA
by celsa-spraggs
DNA sequencing. Why? . – Identifies Organisms. ...
Species
Species
by karlyn-bohler
in natural freshwater. . Central equilibriums in...
Marine monitoring and Natural England
Marine monitoring and Natural England
by liane-varnes
Gavin Black. Specialist . Marine . Monitoring. Ga...
Practical Bioinformatics
Practical Bioinformatics
by calandra-battersby
Community structure . measures for meta-genomics...
8. Limitations
8. Limitations
by liane-varnes
. Habitat map a confined area in the Fal estuary...
Ecology of Open Algae Ponds
Ecology of Open Algae Ponds
by trish-goza
Rob McBride. October. . 2014. Sapphire Produces ...
Chi-Squared Tests in Ecology
Chi-Squared Tests in Ecology
by yoshiko-marsland
The Chi-Squared Test (. . 2. ). The chi-square...
Mann-Whitney U =
Mann-Whitney U =
by sherrill-nordquist
Wilcoxon . rank . sum is the non-parametric test ...
Atte Moilanen, Joona Lehtomäki, Heini Kujala, Federico Mon
Atte Moilanen, Joona Lehtomäki, Heini Kujala, Federico Mon
by myesha-ticknor
C-BIG - Conservation . Biology Informatics Group....
Climate change damage functions in LCA
Climate change damage functions in LCA
by faustina-dinatale
– . (2) data availability and selection of indi...
Overview Purple gromwell (Lithospermum
Overview Purple gromwell (Lithospermum
by luanne-stotts
Overview Purple gromwell (Lithospermum purpurocaer...
Overview Trichia decipiens, Tangancícuaro,
Overview Trichia decipiens, Tangancícuaro,
by sherrill-nordquist
Overview Trichia decipiens, Tangancícuaro, Michoa...