Search Results for 'data species'

data species published presentations and documents on DocSlides.

Veterinary antibiotic consumption in Ireland
Veterinary antibiotic consumption in Ireland
by jordyn
Gavin Ryan. HPRA . 2018 Veterinary Medicines Infor...
MICHIGAN FROG AND TOAD SURVEY         Michigan Department of N
MICHIGAN FROG AND TOAD SURVEY Michigan Department of N
by ellena-manuel
1 . All sites must be easily accessible a...
Developing genome
Developing genome
by liane-varnes
sequencing . for . identification,. detection, . ...
Sediment Quality Assessment and New York City Watersheds
Sediment Quality Assessment and New York City Watersheds
by sherrill-nordquist
NYC Watershed/. Tifft. Science & Technical Sy...
North American Bat Monitoring Program (
North American Bat Monitoring Program (
by trish-goza
NABat. ). . Core Team & Supporters. Susan Lo...
Climate change damage functions in LCA
Climate change damage functions in LCA
by phoebe-click
– . (2) data availability and selection of indi...
Methods
Methods
by trish-goza
Acidification Tolerance of Aquatic Organisms . An...
Tough Times in Death Valley Soils:
Tough Times in Death Valley Soils:
by tatyana-admore
Geochemical . Stressors . and Diversification . o...
Decision Trees in R
Decision Trees in R
by luanne-stotts
Arko. . Barman. Slightly edited by Ch. . Eick. C...
Frontiers
Frontiers
by tawny-fly
in Fuels Science: . Species-Specific Crown Profil...
Developing UK indicators for the Strategic Plan for Biodive
Developing UK indicators for the Strategic Plan for Biodive
by giovanna-bartolotta
Data issues. Any measure of habitat connectivity ...
Global Processes, Including C, N
Global Processes, Including C, N
by alexa-scheidler
Cycles. and the Upper Troposphere and Lower Stra...
PHYLOGENETIC DIVERSITY
PHYLOGENETIC DIVERSITY
by calandra-battersby
Methods and applications. Divya. B.. PK. lab, ....
Mauritius 3D
Mauritius 3D
by sherrill-nordquist
Science alive. Graduation Project. Bodo Schütze,...
ATGTTCTATCCCATTCATTTTGACGTTATTGTTGTTGGAGGAGGTCATGCTGGGACAGA
ATGTTCTATCCCATTCATTTTGACGTTATTGTTGTTGGAGGAGGTCATGCTGGGACAGA
by celsa-spraggs
DNA sequencing. Why? . – Identifies Organisms. ...
Species
Species
by karlyn-bohler
in natural freshwater. . Central equilibriums in...
Marine monitoring and Natural England
Marine monitoring and Natural England
by liane-varnes
Gavin Black. Specialist . Marine . Monitoring. Ga...
Practical Bioinformatics
Practical Bioinformatics
by calandra-battersby
Community structure . measures for meta-genomics...
8.  Limitations
8. Limitations
by liane-varnes
. Habitat map a confined area in the Fal estuary...
Ecology of Open Algae Ponds
Ecology of Open Algae Ponds
by trish-goza
Rob McBride. October. . 2014. Sapphire Produces ...
Chi-Squared Tests in Ecology
Chi-Squared Tests in Ecology
by yoshiko-marsland
The Chi-Squared Test (. . 2. ). The chi-square...
Mann-Whitney U =
Mann-Whitney U =
by sherrill-nordquist
Wilcoxon . rank . sum is the non-parametric test ...
Atte Moilanen, Joona Lehtomäki, Heini Kujala, Federico Mon
Atte Moilanen, Joona Lehtomäki, Heini Kujala, Federico Mon
by myesha-ticknor
C-BIG - Conservation . Biology Informatics Group....
Climate change damage functions in LCA
Climate change damage functions in LCA
by faustina-dinatale
– . (2) data availability and selection of indi...
Will The TMDL Result in Increased Benefits from Recreationa
Will The TMDL Result in Increased Benefits from Recreationa
by lois-ondreau
Doug Lipton. Department of Agricultural & Res...
Ecology of Open Algae Ponds
Ecology of Open Algae Ponds
by liane-varnes
Rob McBride. October. . 2014. Sapphire Produces ...
Rocky Mountain Chapter
Rocky Mountain Chapter
by tawny-fly
Golf Course Superintendents. Association of Ameri...
Emily Finch
Emily Finch
by kittie-lecroy
Department of Biology. Calvin College. Turn down ...
Biodiversity is the variety of plants, animals, and other o
Biodiversity is the variety of plants, animals, and other o
by alexa-scheidler
Abstract. Question. Salinity kit. Soil testing ki...
Development of a cost efficient model for nature conservati
Development of a cost efficient model for nature conservati
by celsa-spraggs
David Lehrer. Advisors. Prof Pua Bar Kutiel and P...
SCE 4310 U01 CLASS #9
SCE 4310 U01 CLASS #9
by tatyana-admore
OCTOBER 18, 2016. AGENDA, NOTES, PHOTOS, RESOURCE...
Meta-analysis of reef fish data in Hawaii to examine natura
Meta-analysis of reef fish data in Hawaii to examine natura
by briana-ranney
Alan Friedlander. 1. , Mary Donovan. 1. ,. Kosta....
Aquatic Invasive Species Distribution
Aquatic Invasive Species Distribution
by conchita-marotz
Geography 1820. Background Information. Aquatic i...
Numbers of Students Who Had
Numbers of Students Who Had
by stefany-barnette
More. Than, Less than,. . or One . Prey . Anima...
Improving gene trees without more data
Improving gene trees without more data
by giovanna-bartolotta
Master Thesis . By. Ashu Gupta. 1. Phylogenetic P...
Use of dynamic factor analysis to estimate trends in abunda
Use of dynamic factor analysis to estimate trends in abunda
by olivia-moreira
Michael Scott Sherburne. Cassidy . D Peterson. Ro...
ATGTTCTATCCCATTCATTTTGACGTTATTGTTGTTGGAGGAGGTCATGCTGGGACAGA
ATGTTCTATCCCATTCATTTTGACGTTATTGTTGTTGGAGGAGGTCATGCTGGGACAGA
by pasty-toler
DNA sequencing. Why? . – Identifies . Organisms...