Explore
Featured
Recent
Articles
Topics
Login
Upload
Featured
Recent
Articles
Topics
Login
Upload
Search Results for 'Orthologs-Species'
Orthologs-Species published presentations and documents on DocSlides.
A B Supplemental Figure S4 Causal-gene orthologs in 12 major crops and model species. (A) Across sp
by evelyn
orthologs. varies across species. Error bars indi...
David Emms d avid.emms@plants.ox.ac.uk
by jaena
Dept. . Plant Sciences, University of Oxford. Laus...
Dissecting plant genomes using
by eve
PLAZA 2.5. Michiel Van Bel. 1,2+. , Sebastian Proo...
TGCAAACTCAAACTCTTTTGTTGTTCTTACTGTATCATTGCCCAGAATAT
by olivia-moreira
TCTGCCTGTCTTTAGAGGCTAATACATTGATTAGTGAATTCCAATGGGC...
Bacterial Comparative Genomics
by alexa-scheidler
Christopher Desjardins, Ph.D.. Earl Lab. Broad In...
Margret Grebowicz When Species Me t Margret Grebowicz When Species Me t Margret Grebowicz When Species Me t Margret Grebowicz When Species Me t Margret Grebowicz When Species Me t
by liane-varnes
envirolinkorgpipermailarnewsWeekofMon20030804 0047...
Orthology -Based Multi-PGDB
by beatrice
Curation. Tools . Suzanne Paley. Pathway Tools Wo...
Data analysis: GO tools, YeastMine, and use case examples
by PeacefulPenguin
SGD: . www.yeastgenome.org. sgd-helpdesk@lists.sta...
Nhx1 Aligning Orthologs
by emily
and Identifying Alleles. Alexis . Valauri. -Orton ...
Protein Structure Investigating DFR specificity in anthocyanin biosynthesis
by luanne-stotts
Fazeeda Hosein. Sarasvati BahadurSingh. Nigel Jal...
Speciation The process by which one species splits into two or more species
by luna
Microevolution to Macroevolution. Biological Speci...
Endangered Species What are endangered species?
by gelbero
Department of Fish and Wildlife. Species that are ...
0 Community Ecology Two-species interactions are classified by the impact each species has on the o
by maniakti
avoiding direct competition.. encouraging mutualis...
Wisconsin’s Threatened and Endangered Species Laws and
by bitsy
Forest T/E Species. Carly Lapin, Wisconsin DNR. Bu...
Biodiversity Estimate over 1.5 million species
by esther
Biodiversity is the number of different species in...
Horizontal transmissibility of the foot-and-mouth disease virus O/JPN/2010 among different species
by beatrice
K. Fukai, T. Nishi, N. Shimada, K. Morioka, M. Yam...
Evolution Gradual change in the genetics of a species/population over time; how descendants differ
by walsh
Evolution & Natural Selection Vocabulary. Type...
Figure Figure. Mayaro virus seroprevalence rates in Neotropical mammal species, according
by bethany
de Thoisy B, Gardon J, Salas RA, Morvan J, Kazanji...
Lesson Plan – Invasive Species
by caitlin
Summary. This lesson will define the term invasive...
An Investigation into the Interactions between Various Amyloid-Beta Species and a Formulated Fluore
by deborah
Justin Debrow, Alexandra Hughes, . Changqing. Che...
L VE-birds In lots of bird species the males and females look different to each other – this
by elyana
sexual dimorphism. .. Male birds often have bright...
Module 17 Evolution of Niches and Species Distributions
by isla
After reading this module you should be able to. E...
Endangered Species Act Consultation
by eve
Endangered Species Act Overview. Signed into law ...
Community Ecology The study of how abundance, diversity, and distributions of species vary due to i
by jainy
abiotic. conditions. A traveler should be a botan...
Chapter 12 Local- species is no longer found in an area it once inhabited
by garcia
Ecological- numbers of species are so few that it ...
Impacts of Landscape Treatments on Plant Species Richness within Road Corridors and Adjacent Ecosys
by ethlyn
Rosalyn Thompson . University College Cork. SIMBIO...
Pre-questions 1. What is species richness? Give an example.
by valerie
2. What is evenness? Give an example.. 3. What bio...
Survivorship curves What do these graphs indicate regarding species survival rate & strategy?
by priscilla
0. 25. 1000. 100. Human. (type I). Hydra. (type II...
The Function of Riparian Reserves for Terrestrial Species:
by osullivan
What was the Intent?. Martin G. Raphael. A primary...
Mimicry Bees and Flies The imitating species is called the
by tracy
mimic. , while the imitated species (protected by ...
Allopolyploid Allopolyploid refers to the contribution of two different species to a polyploidy hyb
by caitlin
An example of a Allopolyploid is a liger. It’s a...
Figure 1 Figure 1. Occurrence of nontuberculous mycobacteria species identified from pulmonary spec
by harmony
Adjemian J, Frankland TB, Daida YG, Honda JR, Oliv...
An introduction to Invasive Non-Native (Alien) Species
by faith
Help! . Our local wildlife is under threat from Al...
Figure 1 Figure 1. Microsporidium species from bone marrow aspiration specimen (Wright sta
by leah
Suankratay C, Thiansukhon E, Nilaratanakul V, Puta...
The Origin of Species chapter 24
by udeline
Campbell . and Reece. Speciation. process by whic...
Appendix 2Flora included in Appendix I Prohibited Species and Append
by davis
156 156 ...
Speciation The formation of new species.
by Ziggystardust
In evolutionary terms a . species . is a group of ...
Factors affecting the evolution of a species
by MoonBabe
Patterns of inheritance. Starter. Natural selecti...
Speciation How do new species originate?
by DreamerDollface
Populations must become isolated. Reproductive iso...
Chapter Introduction How do species adapt to changing environments over time?
by eliza
Chapter Introduction. What do you think?. Before y...
Load More...