Explore
Upload

DocSlides is a free service to upload presentations and documents.

Upload Now

Search Results for 'Orthologs'

Orthologs published presentations and documents on DocSlides.

TGCAAACTCAAACTCTTTTGTTGTTCTTACTGTATCATTGCCCAGAATAT

TGCAAACTCAAACTCTTTTGTTGTTCTTACTGTATCATTGCCCAGAATAT

  • olivia-moreira
  • 43 Slides

TCTGCCTGTCTTTAGAGGCTAATACATTGATTAGTGAATTCCAATGGGC...

Bacterial Comparative Genomics

Bacterial Comparative Genomics

  • alexa-scheidler
  • 0 Slides

Christopher Desjardins, Ph.D.. Earl Lab. Broad In...

Protein Structure Investigating DFR specificity in anthocyanin biosynthesis

Protein Structure Investigating DFR specificity in anthocyanin biosynthesis

  • luanne-stotts
  • 23 Slides

Fazeeda Hosein. Sarasvati BahadurSingh. Nigel Jal...

Dissecting plant genomes using

Dissecting plant genomes using

  • eve
  • 1 Slides

PLAZA 2.5. Michiel Van Bel. 1,2+. , Sebastian Proo...

Nhx1 Aligning Orthologs

Nhx1 Aligning Orthologs

  • emily
  • 26 Slides

and Identifying Alleles. Alexis . Valauri. -Orton ...

Data analysis: GO tools, YeastMine, and use case examples

Data analysis: GO tools, YeastMine, and use case examples

  • PeacefulPenguin
  • 32 Slides

SGD: . www.yeastgenome.org. sgd-helpdesk@lists.sta...

David Emms d avid.emms@plants.ox.ac.uk

David Emms d avid.emms@plants.ox.ac.uk

  • jaena
  • 42 Slides

Dept. . Plant Sciences, University of Oxford. Laus...

Orthology -Based Multi-PGDB

Orthology -Based Multi-PGDB

  • beatrice
  • 10 Slides

Curation. Tools . Suzanne Paley. Pathway Tools Wo...

A B Supplemental Figure S4 Causal-gene orthologs in 12 major crops and model species. (A) Across sp

A B Supplemental Figure S4 Causal-gene orthologs in 12 major crops and model species. (A) Across sp

  • evelyn
  • 1 Slides

orthologs. varies across species. Error bars indi...

Copyright © 2024 DocSlides. All Rights Reserved