Upload
Featured Recent Articles Topics Login Upload

Search Results for 'Ortholog'

Ortholog published presentations and documents on DocSlides.

A B Supplemental Figure S4 Causal-gene orthologs in 12 major crops and model species. (A) Across sp
A B Supplemental Figure S4 Causal-gene orthologs in 12 major crops and model species. (A) Across sp
by evelyn
orthologs. varies across species. Error bars indi...
Homologues, orthologues and paralogues• Homology: share a common
Homologues, orthologues and paralogues• Homology: share a common
by debby-jeon
Homologues, orthologues and paralogues• Ortho...
Orthology -Based Multi-PGDB
Orthology -Based Multi-PGDB
by beatrice
Curation. Tools . Suzanne Paley. Pathway Tools Wo...
Sequence alignments 2: Dynamic programming and an exercise
Sequence alignments 2: Dynamic programming and an exercise
by claire
Hardison. Genomics 4_2. Sources: Webb Miller (Penn...
David Emms d avid.emms@plants.ox.ac.uk
David Emms d avid.emms@plants.ox.ac.uk
by jaena
Dept. . Plant Sciences, University of Oxford. Laus...
Data analysis: GO tools, YeastMine, and use case examples
Data analysis: GO tools, YeastMine, and use case examples
by PeacefulPenguin
SGD: . www.yeastgenome.org. sgd-helpdesk@lists.sta...
Nhx1 Aligning Orthologs
Nhx1 Aligning Orthologs
by emily
and Identifying Alleles. Alexis . Valauri. -Orton ...
Dissecting plant genomes using
Dissecting plant genomes using
by eve
PLAZA 2.5. Michiel Van Bel. 1,2+. , Sebastian Proo...
Protein Structure Investigating DFR specificity in anthocyanin biosynthesis
Protein Structure Investigating DFR specificity in anthocyanin biosynthesis
by luanne-stotts
Fazeeda Hosein. Sarasvati BahadurSingh. Nigel Jal...
Annotation for D. virilis
Annotation for D. virilis
by pamella-moone
Chris Shaffer July 2012. Last update: 08/2018. A...
Homology, Orthology , and Trees
Homology, Orthology , and Trees
by phoebe-click
Benjamin J. . Liebeskind. Post-doctoral Fellow, U...
Evolutionary model for the statistical divergence of paralogous and orthologous gene pairs generate
Evolutionary model for the statistical divergence of paralogous and orthologous gene pairs generate
by tatyana-admore
Yue Zhang, . Chunfang. Zheng, David . Sankoff. P...
Bacterial Comparative Genomics
Bacterial Comparative Genomics
by alexa-scheidler
Christopher Desjardins, Ph.D.. Earl Lab. Broad In...
Functional organization of the yeast proteome by systematic
Functional organization of the yeast proteome by systematic
by tatyana-admore
Presented by Nathalie . Kirshman. and Xinyi Ma. ...
TGCAAACTCAAACTCTTTTGTTGTTCTTACTGTATCATTGCCCAGAATAT
TGCAAACTCAAACTCTTTTGTTGTTCTTACTGTATCATTGCCCAGAATAT
by olivia-moreira
TCTGCCTGTCTTTAGAGGCTAATACATTGATTAGTGAATTCCAATGGGC...
Integrated Bioinformatics
Integrated Bioinformatics
by jane-oiler
Data . and Analysis . Tools for . Herpesviridae. ...