Explore
Upload

DocSlides is a free service to upload presentations and documents.

Upload Now

Search Results for 'Homology'

Homology published presentations and documents on DocSlides.

ANINTRODUCTIONTOKNOTFLOERHOMOLOGYCIPRIANMANOLESCUAbstract.Thisisasurve

ANINTRODUCTIONTOKNOTFLOERHOMOLOGYCIPRIANMANOLESCUAbstract.Thisisasurve

  • lois-ondreau
  • 31 Slides

TheauthorwaspartiallysupportedbyNSFgrantnumberDMS-...

Homologues, orthologues and paralogues• Homology: share a common

Homologues, orthologues and paralogues• Homology: share a common

  • debby-jeon
  • 46 Slides

Homologues, orthologues and paralogues• Ortho...

PLUMBED HOMOLOGY oriented 3-manifold M 3

PLUMBED HOMOLOGY oriented 3-manifold M 3

  • cheryl-pisano
  • 20 Slides

n ~ 5 , C 3 . one can 3 3 M 3 M 3 The map C 3 ...

0 Chapter 19

0 Chapter 19

  • calandra-battersby
  • 15 Slides

Homologous and Analogous Structures. Need to Know...

Homology curation at SGD:

Homology curation at SGD:

  • lindy-dunigan
  • 12 Slides

budding yeast as a model for eukaryotic biology. ...

Four novel 

Four novel 

  • jane-oiler
  • 1 Slides

Rhodococcus. . erythropolis.  phages were isola...

Homology Based Analysis of the Human/Mouse

Homology Based Analysis of the Human/Mouse

  • tatiana-dople
  • 28 Slides

lncRNome. Cédric Notredame. Giovanni . Bussotti....

Functional Analysis Cassettes with Long Flanking Homology Regions Gene

Functional Analysis Cassettes with Long Flanking Homology Regions Gene

  • calandra-battersby
  • 100 Slides

Table 1. in this study. Restriction site(s) PmeI h...

Vibrio

Vibrio

  • luanne-stotts
  • 40 Slides

genome analysis. Christina. Isabella. Roland. Sa...

A 2-category of

A 2-category of

  • myesha-ticknor
  • 31 Slides

dotted. . cobordisms. and a . universal. . odd...

Gregory Moore, Rutgers University

Gregory Moore, Rutgers University

  • calandra-battersby
  • 101 Slides

Brandeis, March 6, 2015. collaborati...

Visualizing

Visualizing

  • tatiana-dople
  • 45 Slides

Multi-dimensional . Persistent Homology. Matthew ...

“Homology-enhanced probabilistic consistency” multiple

“Homology-enhanced probabilistic consistency” multiple

  • liane-varnes
  • 27 Slides

a case study on transmembrane protein. Jia-Ming C...

Blast

Blast

  • conchita-marotz
  • 55 Slides

output. How to . measure. the similarity between...

Three Simple Steps with Red/ET

Three Simple Steps with Red/ET

  • calandra-battersby
  • 100 Slides

TECHNOLOGY TECHNOLOGY 4 1. Attachment of homology ...

Last lecture summary

Last lecture summary

  • yoshiko-marsland
  • 36 Slides

identity vs. similarity. homology vs. similarity....

A 2-category of

A 2-category of

  • liane-varnes
  • 29 Slides

dotted. . cobordisms. and a . universal. . odd...

Some Topics in Computational Topology

Some Topics in Computational Topology

  • trish-goza
  • 69 Slides

Yusu. . Wang. Ohio State University. AMS Short C...

History of Life

History of Life

  • debby-jeon
  • 25 Slides

Biogeography | Homologies. Learning Objectives. D...

What causes the

What causes the "struggle for existence"?

  • yoshiko-marsland
  • 43 Slides

Which animal has INCREASED fitness?. Living in a ...

Molecular Simulation

Molecular Simulation

  • celsa-spraggs
  • 39 Slides

Molecular Simluation. Introduction:. Prerequisiti...

MATH:7450 (22M:305) Topics in Topology: Scientific and Engi

MATH:7450 (22M:305) Topics in Topology: Scientific and Engi

  • tatiana-dople
  • 53 Slides

Nov . 18, . 2013: . Viral Evolution II and. Crick...

Systematics Lecture 3 – Characters: Homology, Morphology

Systematics Lecture 3 – Characters: Homology, Morphology

  • mitsue-stanley
  • 11 Slides

Character by Taxon Matrix. Definition . – A cha...

tcacctcctgtagggcatct

tcacctcctgtagggcatct

  • tawny-fly
  • 4 Slides

▽. tggttgtttccaccttttgg. atgcatagtcacctttttga. ...

Persistent homology I

Persistent homology I

  • phoebe-click
  • 38 Slides

Peter K. álnai. Autumn school.  . Department . ...

MAFFT:

MAFFT:

  • lois-ondreau
  • 20 Slides

Multiple Sequence Alignment using Fast Fourier Tr...

Manifold Learning Via Homology

Manifold Learning Via Homology

  • aaron
  • 36 Slides

Presenter: Ronen . Talmon. Topological Methods in...

Comparative genomics

Comparative genomics

  • olivia-moreira
  • 24 Slides

Joachim Bargsten. February 2012. Comparative . ge...

Theory of Evolution

Theory of Evolution

  • conchita-marotz
  • 21 Slides

Data Driven Process Supported by Evidence. TEKS. ...

Homology 3D modeling and effect of mutations

Homology 3D modeling and effect of mutations

  • lindy-dunigan
  • 44 Slides

Miguel . Andrade. Faculty of Biology, . Johannes ...

Axl homology modeling

Axl homology modeling

  • faustina-dinatale
  • 10 Slides

Mgr. Juraj Dobiaš. Mollard. , A.;. Warner,. S....

EVIDENCES OF EVOLUTION

EVIDENCES OF EVOLUTION

  • min-jolicoeur
  • 40 Slides

TEST. MARKS-14½. What is doctrine of evolution?....

Rob Russell

Rob Russell

  • giovanna-bartolotta
  • 18 Slides

Cell Networks. University of Heidelberg. Interact...

TDA is a form of

TDA is a form of

  • faustina-dinatale
  • 82 Slides

Exploratory Data Analysis (EDA. ). https://online...

Topological Data Analysis

Topological Data Analysis

  • ellena-manuel
  • 46 Slides

Applications II. This work was partially supporte...

CDGO 2007: 2nd International Confere

CDGO 2007: 2nd International Confere

  • lois-ondreau
  • 35 Slides

on Complementarity,. . Duality and Global Optimi...

Homology, Orthology , and Trees

Homology, Orthology , and Trees

  • phoebe-click
  • 0 Slides

Benjamin J. . Liebeskind. Post-doctoral Fellow, U...

Computing Persistent Homology

Computing Persistent Homology

  • lindy-dunigan
  • 0 Slides

Matthew L. Wright. Institute for Mathematics and ...

PROTEIN MODELLING Presented

PROTEIN MODELLING Presented

  • conchita-marotz
  • 0 Slides

by . Sadhana S. definition. Protein structure pre...

MATH:7450 (22M:305) Topics in Topology: Scientific and Engineering Applications of Algebraic Topolo

MATH:7450 (22M:305) Topics in Topology: Scientific and Engineering Applications of Algebraic Topolo

  • pamella-moone
  • 0 Slides

Sept 4, 2013. Clustering Via Persistent Homology....

Copyright © 2024 DocSlides. All Rights Reserved