Upload
Featured Recent Articles Topics Login Upload

Search Results for 'Dna-Primers'

Dna-Primers published presentations and documents on DocSlides.

Designing the oligonucleotide primers for
Designing the oligonucleotide primers for
by alis
PCR. GENE TECHNIQUES . . Dr. Nadal A...
PCR way of copying specific DNA fragments from small sample DNA material
PCR way of copying specific DNA fragments from small sample DNA material
by alida-meadow
"molecular photocopying" . It’s fast, inexpensi...
4 th Lab
4 th Lab
by eliza
Primer Design & Blast . Lecture Kamaran Mustaf...
Yeast Colony PCR PCR provides a forensics tool for identifying colonies
Yeast Colony PCR PCR provides a forensics tool for identifying colonies
by layla
Three strains look alike!. How can you identify th...
Figure 1 Figure 1. A) Specificity of primers for PARV4. Samples in lanes 1–5 were amplif
Figure 1 Figure 1. A) Specificity of primers for PARV4. Samples in lanes 1–5 were amplif
by berey
Fryer JF, Kapoor A, Minor PD, Delwart E, Baylis SA...
Unit 2: The Genome Chapter 6 - Polymerase Chain Reaction
Unit 2: The Genome Chapter 6 - Polymerase Chain Reaction
by samantha
Figure 6.01. Polymerase Chain Reaction (PCR). Duri...
Molecular diagnosis of human
Molecular diagnosis of human
by HotMess
papillomavirus. (HPV)oral infections. . Dr. Osam...
Sompong Te-chato and Mii MasahiroTe-chato, S., Lim, M. and Masahir
Sompong Te-chato and Mii MasahiroTe-chato, S., Lim, M. and Masahir
by grewhypo
ORIGINAL ARTICLE ORIGINAL ARTICLE  " ...
Analysis of Three Plant Primers:
Analysis of Three Plant Primers:
by lois-ondreau
rbcL. , plant ITS, and . matK. , . to Determine t...
Using DNA Barcodes to Identify Mislabeled Red Snappers Sold
Using DNA Barcodes to Identify Mislabeled Red Snappers Sold
by alexa-scheidler
New . York City Fish Markets . Ajenae. Jackson. ...
Analysis of Three Plant Primers:
Analysis of Three Plant Primers:
by lois-ondreau
rbcL. , plant ITS, and . matK. , . to Determine t...
Polymerase Chain Reaction (PCR)
Polymerase Chain Reaction (PCR)
by debby-jeon
Nahla . Bakhamis. Multiple copies of specific DNA...
Yeast Colony PCR
Yeast Colony PCR
by sherrill-nordquist
PCR provides a forensics tool for identifying col...
Figure 2 Figure 2. Sequences of Plasmodium vivax isolates are distinguished by variation i
Figure 2 Figure 2. Sequences of Plasmodium vivax isolates are distinguished by variation i
by linda
Li J, Collins WE, Wirtz RA, Rathore D, Lal A, McCu...
Non-human Cell Line Authentication
Non-human Cell Line Authentication
by margaret
Methods to Authenticate . Non-human Cells. Identif...
Dot plot
Dot plot
by tawny-fly
Daniel Svozil. Software choice. source: Bioinform...
DNA damage DNA gets damaged a lot ! DNA damage DNA gets damaged a
DNA damage DNA gets damaged a lot ! DNA damage DNA gets damaged a
by faustina-dinatale
DNA damage DNA gets damaged a lot ! DNA damage ...
CHAPTER 9. DNA Sequencing I
CHAPTER 9. DNA Sequencing I
by udeline
The Sanger method. DNA sequencing is the primary m...
Figure 6 Figure 6. . Genotypic characterization of wild-type flagellates by PCR amplification with
Figure 6 Figure 6. . Genotypic characterization of wild-type flagellates by PCR amplification with
by nicole
Teixeira A, Monteiro P, Rebelo JM, Argañaraz ER, ...
Figure 1 Figure 1. Verification of toxin gene deletions and the genetic structure of the construct
Figure 1 Figure 1. Verification of toxin gene deletions and the genetic structure of the construct
by elina
Plaut RD, Staab AB, Munson MA, Gebhardt JS, Klimko...
G.tigrina Hox gene DthoxC
G.tigrina Hox gene DthoxC
by gabriella
insertion into prokaryote . E.coli. . – by . UN...
Bioinformatics Methods for Diagnosis and Treatment of Human Diseases
Bioinformatics Methods for Diagnosis and Treatment of Human Diseases
by nonhurmer
Jorge . Duitama. Dissertation Proposal for the Deg...
Choosing the Correct Primer
Choosing the Correct Primer
by jane-oiler
Primers Solve Problems. Stain and Odors. Porous S...
Choosing the Correct Primer
Choosing the Correct Primer
by sherrill-nordquist
Primers Solve Problems. Stain and Odors. Porous S...
Outbreak of
Outbreak of
by alexa-scheidler
E. coli . O104:H4 heralds a new paradigm in respo...
Why NCBI Tools are important for
Why NCBI Tools are important for
by natalia-silvester
breeding. plants . studies. genetically. . modi...
G.tigrina
G.tigrina
by sherrill-nordquist
. Hox. gene . DthoxC. insertion into prokaryot...
The role of nutrition in DNA replication, DNA damage prevention and DNA repair
The role of nutrition in DNA replication, DNA damage prevention and DNA repair
by rodriguez
 . Author: Michael Fenech. Affiliation: Genome H...
DNA (Test 1) 3. When DNA replicates, each strand of the original DNA molecule is used as a templat
DNA (Test 1) 3. When DNA replicates, each strand of the original DNA molecule is used as a templat
by pamella-moone
7. Lactose digestions in . E. coli. begins with ...
Zoo 651 - Content - Cell
Zoo 651 - Content - Cell
by violet
culture.. ELISA.. Comet . assay. .. MTT . assay.. ...
Dr. A Prakash Polymerase chain reaction (PCR)
Dr. A Prakash Polymerase chain reaction (PCR)
by naomi
Key points:. Polymerase chain reaction. , or . PC...
Identification of Bacteria
Identification of Bacteria
by dandy
BBT201. Ach . Importance . of . Bacteria identific...
Pere Ars Institut de Recerca i Tecnologia Agroalimentries IRTA Sp
Pere Ars Institut de Recerca i Tecnologia Agroalimentries IRTA Sp
by osullivan
reproduce modified versions of Figures 4-3, 11-12,...
Pere Ars Institut de Recerca i Tecnologia Agroalimentries IRTA Sp
Pere Ars Institut de Recerca i Tecnologia Agroalimentries IRTA Sp
by iris
reproduce modified versions of Figures 4-3, 11-12,...
Genetics and Molecular Research 16 3 gmr16039796
Genetics and Molecular Research 16 3 gmr16039796
by oneill
Improving the PCR protocol to amplify a repetitiv...
Site Directed Mutagenesis of ZsYellow
Site Directed Mutagenesis of ZsYellow
by garcia
102 103 LAB OVERVIEWZsYellow is a yellow fluoresce...
Genetics Engineering Lecture-3
Genetics Engineering Lecture-3
by Mindbender
Concept and basic steps in recombinant DNA technol...
Pcr MARCH 10, 2015 Lab 7
Pcr MARCH 10, 2015 Lab 7
by SweetMelody
Biol. 1208(r). overview. Where are we today?. How...
ATGTTCTATCCCATTCATTTTGACGTTATTGTTGTTGGAGGAGGTCATGCTGGGACAGAAGCAGCTTTGGCTTCTGCTAGGATGCAATGTAATACGCTT
ATGTTCTATCCCATTCATTTTGACGTTATTGTTGTTGGAGGAGGTCATGCTGGGACAGAAGCAGCTTTGGCTTCTGCTAGGATGCAATGTAATACGCTT
by jainy
DNA sequencing. Why? . – Identifies . Organisms....
nrnnJohn HydeNOAASouthwest Fisheries Science CenterLa Jolla California
nrnnJohn HydeNOAASouthwest Fisheries Science CenterLa Jolla California
by amelia
December 6 201323rrNot all specimens need to be ge...