PPT-Friday 11/14/2014
Take a notes sheet from the front table Get out your warmup sheet amp answer the following What is the complementary strand for the below DNA strand ACTGCACCTGAGCGTATTGAC
Download Presentation
"Friday 11/14/2014" is the property of its rightful owner. Permission is granted to download and print materials on this website for personal, non-commercial use only, provided you retain all copyright notices. By downloading content from our website, you accept the terms of this agreement.
Presentation Transcript
Transcript not available.