Author : lydia | Published Date : 2021-01-05
Table S1 Primers used in this study Primers name Gene name Primer sequence 5x0027 3x0027 References Autotransporter ehaA α F z0402 ehaA ATATCGGCTAAAGTGGAACAGGTCC 1 ehaA α R
Download Presentation The PPT/PDF document "SUPPLEMENTAL DATA" is the property of its rightful owner. Permission is granted to download and print the materials on this web site for personal, non-commercial use only, and to display it on your personal computer provided you do not modify the materials and that you retain all copyright notices contained in the materials. By downloading content from our website, you accept the terms of this agreement.
Copyright © 2024 DocSlides. All Rights Reserved