DocSlides

PDF-DNA Insertions and Deletions

SO

lois-ondreau

Published 2016-04-28 | 5344 Views

DNA Insertions and Deletions
in the Human Genome Philipp W Messer GeneticVariation CGACAATAGCGCTCTTACTACGTGTATCG CGACAATGGCGCTACTACGTGCATCG 1Nucleotide mutations 2Genomic rearrangements 3DNA

Download Presentation

Download Presentation The PPT/PDF document "DNA Insertions and Deletions" is the property of its rightful owner. Permission is granted to download and print the materials on this website for personal, non-commercial use only, and to display it on your personal computer provided you do not modify the materials and that you retain all copyright notices contained in the materials. By downloading content from our website, you accept the terms of this agreement.

Presentation Transcript

Related Topics