Download Presentation
PPT-kb EC1000 MC1061 Gel of PCR Results Using

PPT-kb EC1000 MC1061 Gel of PCR Results Using

repA primers pWV01 RSDWV rep F GAGTTTGGGCGTATCTATGGC RSDWV rep R CCCGTTTCAGCATCAAGAACC This was a colony PCR producing an expected 600 bp amplicon PCR conditions

Presentation Embed Code

Download Presentation

Download Presentation The PPT/PDF document "kb EC1000 MC1061 Gel of PCR Results Usin..." is the property of its rightful owner. Permission is granted to download and print the materials on this web site for personal, non-commercial use only, and to display it on your personal computer provided you do not modify the materials and that you retain all copyright notices contained in the materials. By downloading content from our website, you accept the terms of this agreement.

kb EC1000 MC1061 Gel of PCR Results Using: Transcript

Show More