Explore
Upload

DocSlides is a free service to upload presentations and documents.

Upload Now
Video Images
Download Presentation

PDF-JOURNALOFBACTERIOLOGYDec1987p54295433Vol169No12002191938712 PDF document

102030405060708090AATTCTGCCGCCACCTCGCGAATAATGTGGATGCTTTCCGCCTCCAGTTGCCGCAGGTGAGTAAGTCGTATTTGATCCATAACCGTTCCT100110120130140150160170180TTGCAATACCGCTATTTTCTTGCCATCAGATGTTTCGACTATAGGGAGCGTAAGAGAACGAATGA

nakata fig shinagawa iap fig nakata iap shinagawa 1987 biol 35s amemura anda mol rev lane3 bacteriol andl makino

Presentation Embed Code

Download Presentation

Download Presentation The PPT/PDF document "JOURNALOFBACTERIOLOGYDec1987p54295433Vol..." is the property of its rightful owner. Permission is granted to download and print the materials on this web site for personal, non-commercial use only, and to display it on your personal computer provided you do not modify the materials and that you retain all copyright notices contained in the materials. By downloading content from our website, you accept the terms of this agreement.

JOURNALOFBACTERIOLOGYDec1987p54295433Vol169No12002191938712: Transcript

Show More

Related Contents

Copyright © 2024 DocSlides. All Rights Reserved