PPT-POLYMORPHISM AND VARIANT ANALYSIS

Matt Hudson Crop Sciences NCSA HPCBio IGB University of Illinois Outline How do we predict molecular or genetic functions using variants Predicting when a coding

aacgagctagcgatcgatcgactacgactacgaggt disease gwas snps disease aacgagctagcgatcgatcgactacgactacgaggt snps gwas snp association test control case position classifier common genome population false coding predict million

Presentation Embed Code

<iframe width="560" height="315" src="https://www.docslides.com/embed/618025" frameborder="0" allowfullscreen></iframe>

Download Presentation

Download Presentation The PPT/PDF document "POLYMORPHISM AND VARIANT ANALYSIS" is the property of its rightful owner. Permission is granted to download and print the materials on this web site for personal, non-commercial use only, and to display it on your personal computer provided you do not modify the materials and that you retain all copyright notices contained in the materials. By downloading content from our website, you accept the terms of this agreement.