PPT- Marker name

SNP or ploymorphism source Marker type Forward primer 1 Forward primer 2 Reverse primer M1 Ebmac0415 SSR GAAACCCATCATAGCAGC AAACAGCAGCAAGAGGAG M2 HVM54 SSR AACCCAGTAACACCGTCCTG

Upload by brooke
Published on 2024-03-13

Presentation Embed Code

<iframe width="560" height="315" src="https://www.docslides.com/embed/1047309" frameborder="0" allowfullscreen></iframe>

Download Presentation

Download Presentation The PPT/PDF document " Marker name" is the property of its rightful owner. Permission is granted to download and print the materials on this web site for personal, non-commercial use only, and to display it on your personal computer provided you do not modify the materials and that you retain all copyright notices contained in the materials. By downloading content from our website, you accept the terms of this agreement.