PDF-All S enterica serovar Typhimurium strains are derived from strain

codon of the corresponding open reading frames as follows a cat gene fragment was amplified from plasmid pKD3 using the spoT 5

clps flag spot protein flag clps protein spot proteins anti phop tatgaatatcctccttagt buffer study gactacaaggacgacgatgacaagtaagtgtaggctggagctgcttc putative fig substrates dna

Presentation Embed Code

<iframe width="560" height="315" src="https://www.docslides.com/embed/839972" frameborder="0" allowfullscreen></iframe>

Download Presentation

Download Presentation The PPT/PDF document "All S enterica serovar Typhimurium strai..." is the property of its rightful owner. Permission is granted to download and print the materials on this web site for personal, non-commercial use only, and to display it on your personal computer provided you do not modify the materials and that you retain all copyright notices contained in the materials. By downloading content from our website, you accept the terms of this agreement.